Incidental Mutation 'R0412:Kcmf1'
ID36709
Institutional Source Beutler Lab
Gene Symbol Kcmf1
Ensembl Gene ENSMUSG00000055239
Gene Namepotassium channel modulatory factor 1
Synonyms1700094M07Rik, clone DEBT-91, Pmcf
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0412 (G1)
Quality Score152
Status Validated
Chromosome6
Chromosomal Location72841114-72899979 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 72848241 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 239 (Q239*)
Ref Sequence ENSEMBL: ENSMUSP00000144910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068697] [ENSMUST00000204598] [ENSMUST00000204708] [ENSMUST00000206378]
Predicted Effect probably null
Transcript: ENSMUST00000068697
AA Change: Q290*
SMART Domains Protein: ENSMUSP00000064410
Gene: ENSMUSG00000055239
AA Change: Q290*

DomainStartEndE-ValueType
ZnF_ZZ 3 48 6.05e-14 SMART
ZnF_C2H2 78 101 3.16e-3 SMART
low complexity region 157 168 N/A INTRINSIC
low complexity region 175 192 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 331 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203431
Predicted Effect probably null
Transcript: ENSMUST00000204598
AA Change: Q239*
SMART Domains Protein: ENSMUSP00000144910
Gene: ENSMUSG00000055239
AA Change: Q239*

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.4e-5 SMART
Blast:ZnF_C2H2 57 85 9e-6 BLAST
low complexity region 106 117 N/A INTRINSIC
low complexity region 124 141 N/A INTRINSIC
coiled coil region 173 208 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204708
Predicted Effect probably benign
Transcript: ENSMUST00000206378
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit some perinatal and postnatal lethality but mice that survive to adulthood exhibit normal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Kcmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Kcmf1 APN 6 72858883 missense possibly damaging 0.95
IGL03057:Kcmf1 APN 6 72843027 missense probably benign 0.02
IGL03372:Kcmf1 APN 6 72849563 missense probably damaging 0.99
IGL03098:Kcmf1 UTSW 6 72849584 start codon destroyed probably null
R0080:Kcmf1 UTSW 6 72850487 splice site probably null
R0082:Kcmf1 UTSW 6 72850487 splice site probably null
R0226:Kcmf1 UTSW 6 72842952 missense probably benign
R0402:Kcmf1 UTSW 6 72849585 start codon destroyed probably null
R0616:Kcmf1 UTSW 6 72850484 missense probably benign 0.08
R1087:Kcmf1 UTSW 6 72858880 missense probably damaging 1.00
R1383:Kcmf1 UTSW 6 72849582 missense possibly damaging 0.94
R1533:Kcmf1 UTSW 6 72843020 missense possibly damaging 0.49
R1544:Kcmf1 UTSW 6 72848229 missense probably benign
R2355:Kcmf1 UTSW 6 72850483 missense probably damaging 1.00
R2380:Kcmf1 UTSW 6 72858772 critical splice donor site probably null
R3103:Kcmf1 UTSW 6 72861847 missense probably damaging 1.00
R4533:Kcmf1 UTSW 6 72849591 missense probably damaging 1.00
R5450:Kcmf1 UTSW 6 72842930 nonsense probably null
R5927:Kcmf1 UTSW 6 72843005 missense possibly damaging 0.49
R6467:Kcmf1 UTSW 6 72843099 missense probably damaging 0.99
R7048:Kcmf1 UTSW 6 72849467 missense probably damaging 1.00
R7089:Kcmf1 UTSW 6 72842946 missense probably benign 0.26
R7089:Kcmf1 UTSW 6 72848306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAGGCTCCAAGTTCTGAGTGAG -3'
(R):5'- TGGCACCAGGTTTTCCTGTCAAG -3'

Sequencing Primer
(F):5'- tttctcactaaacttgaaccttacc -3'
(R):5'- GGGGACAGCTTAACTCTTCAG -3'
Posted On2013-05-09