Incidental Mutation 'R4786:Olfr954'
ID367103
Institutional Source Beutler Lab
Gene Symbol Olfr954
Ensembl Gene ENSMUSG00000094745
Gene Nameolfactory receptor 954
SynonymsGA_x6K02T2PVTD-33158015-33158950, MOR171-53, MOR171-42
MMRRC Submission 041995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4786 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39456701-39464625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39461841 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 134 (I134L)
Ref Sequence ENSEMBL: ENSMUSP00000151116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
Predicted Effect probably benign
Transcript: ENSMUST00000080329
AA Change: I137L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: I137L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214818
AA Change: I134L

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,536 I134N possibly damaging Het
Acvr1c T C 2: 58,280,354 Y414C probably damaging Het
Adam32 A C 8: 24,863,493 S693R probably damaging Het
Aldh2 A T 5: 121,572,824 F314Y probably benign Het
Anks1 A G 17: 28,052,730 D874G possibly damaging Het
Ap4b1 T A 3: 103,818,804 V372E probably benign Het
Aqp12 G A 1: 93,006,455 C18Y probably damaging Het
Arap1 T A 7: 101,385,005 I218N possibly damaging Het
Arhgap42 C A 9: 9,238,698 E28* probably null Het
Asb5 G A 8: 54,585,839 E247K probably benign Het
Atg9b T C 5: 24,386,089 D781G possibly damaging Het
Atxn10 A G 15: 85,387,143 H294R probably benign Het
Bod1l G T 5: 41,819,438 T1511K probably benign Het
Btnl2 A T 17: 34,363,348 N296I probably damaging Het
Camta1 A T 4: 151,290,039 L168H probably damaging Het
Cant1 A T 11: 118,408,839 V265E possibly damaging Het
Ccdc157 T C 11: 4,151,861 D20G probably damaging Het
Cd209c T G 8: 3,945,698 T35P possibly damaging Het
Cdc20b G A 13: 113,078,734 V279M probably damaging Het
Cdh18 T A 15: 23,410,787 W453R probably null Het
Cdh24 A G 14: 54,637,550 S333P possibly damaging Het
Ceacam11 T C 7: 17,972,314 probably null Het
Ciz1 C T 2: 32,377,527 P150L probably damaging Het
Crip3 C A 17: 46,431,042 Q152K possibly damaging Het
Dars2 G A 1: 161,060,760 R197W probably damaging Het
Dctn4 A G 18: 60,555,195 D394G probably damaging Het
Dido1 T C 2: 180,670,871 Y1077C possibly damaging Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egln3 A T 12: 54,185,581 I146N probably damaging Het
Eif2ak3 C T 6: 70,892,618 T763M possibly damaging Het
Etfbkmt A T 6: 149,147,246 M1L probably benign Het
Fam171a1 A T 2: 3,225,578 I583F probably damaging Het
Fbxo38 A C 18: 62,529,674 L249W probably damaging Het
Fxyd5 T C 7: 31,041,482 probably benign Het
Gabrr3 C A 16: 59,430,100 T154K probably benign Het
Gm7233 C A 14: 43,180,890 D90E probably benign Het
Gm8186 A G 17: 26,099,040 V61A probably benign Het
Gm9573 A T 17: 35,619,329 probably benign Het
Gnao1 A G 8: 93,944,303 I137V probably benign Het
Gnptab A G 10: 88,436,182 M945V probably damaging Het
Gpsm1 G A 2: 26,322,481 A78T probably benign Het
Gtf2b T C 3: 142,781,469 L222P probably damaging Het
Hnrnpf A G 6: 117,923,896 Y47C probably damaging Het
Itga6 A G 2: 71,838,690 N608S possibly damaging Het
Kdm2b T C 5: 122,880,854 probably null Het
Krit1 T A 5: 3,812,467 H207Q possibly damaging Het
Ky A G 9: 102,541,987 N398D probably benign Het
Lama1 T A 17: 67,773,859 V1294E possibly damaging Het
Lef1 C T 3: 131,111,524 T18I probably damaging Het
Lrp2 T C 2: 69,537,956 N178S probably damaging Het
Lrrc36 A G 8: 105,455,278 T525A probably benign Het
Map3k8 A T 18: 4,340,647 C222* probably null Het
Mapre2 G C 18: 23,877,959 S199T probably benign Het
Mcm3ap A G 10: 76,488,466 N911S probably benign Het
Mroh4 G T 15: 74,610,234 H722Q probably benign Het
Myo5b A C 18: 74,695,380 Y701S probably benign Het
Myt1l G T 12: 29,811,458 V80L unknown Het
Ncoa7 C A 10: 30,655,642 V24L probably benign Het
Nlrp10 A T 7: 108,925,238 V345D probably damaging Het
Nmral1 C A 16: 4,716,424 G51V probably damaging Het
Npc1 A G 18: 12,199,497 I797T probably benign Het
Olfr1269 A T 2: 90,119,007 I197N possibly damaging Het
Olfr936 T A 9: 39,047,487 R22* probably null Het
Pclo A T 5: 14,723,267 I4419F unknown Het
Phf3 C A 1: 30,816,557 E983* probably null Het
Pitpnm2 A T 5: 124,121,743 Y1149* probably null Het
Sdc3 A T 4: 130,822,768 T430S probably damaging Het
Sema3f A G 9: 107,682,682 V671A probably benign Het
Sigirr T G 7: 141,091,433 S379R probably benign Het
Slc25a23 T A 17: 57,047,326 N360I possibly damaging Het
Slco6c1 A T 1: 97,087,995 M357K probably benign Het
Sox14 C A 9: 99,874,965 M240I probably benign Het
Stradb A T 1: 58,991,208 probably benign Het
Szt2 A T 4: 118,399,062 M200K probably benign Het
Tef T C 15: 81,815,252 S85P probably benign Het
Thada T A 17: 84,458,855 H41L possibly damaging Het
Tinagl1 A G 4: 130,173,931 F90S probably benign Het
Tnfaip1 G A 11: 78,530,219 T5I possibly damaging Het
Tnfrsf23 A T 7: 143,680,064 V59D probably damaging Het
Tnpo3 A G 6: 29,578,542 V311A probably benign Het
Trak1 T A 9: 121,472,494 M772K probably benign Het
Ubash3a A G 17: 31,217,964 D185G probably benign Het
Vmn2r120 T C 17: 57,522,048 T516A probably benign Het
Wdr4 A C 17: 31,509,811 L130R probably damaging Het
Zfp12 T C 5: 143,245,502 I528T probably damaging Het
Zfp607a T C 7: 27,879,413 L636P probably damaging Het
Other mutations in Olfr954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Olfr954 APN 9 39462283 missense probably damaging 0.98
IGL02793:Olfr954 APN 9 39461506 missense probably benign 0.09
IGL02964:Olfr954 APN 9 39461781 missense possibly damaging 0.88
IGL02979:Olfr954 APN 9 39461523 missense probably benign 0.02
R0041:Olfr954 UTSW 9 39461476 missense probably benign 0.34
R0153:Olfr954 UTSW 9 39461671 missense probably damaging 0.99
R0269:Olfr954 UTSW 9 39461794 missense probably damaging 1.00
R0426:Olfr954 UTSW 9 39461593 missense probably damaging 1.00
R0731:Olfr954 UTSW 9 39461532 missense probably damaging 1.00
R1800:Olfr954 UTSW 9 39462114 missense probably damaging 1.00
R2340:Olfr954 UTSW 9 39461809 missense probably damaging 1.00
R2901:Olfr954 UTSW 9 39461938 missense probably damaging 0.97
R2912:Olfr954 UTSW 9 39462216 missense probably damaging 1.00
R2939:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R2940:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3081:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3765:Olfr954 UTSW 9 39461624 nonsense probably null
R4450:Olfr954 UTSW 9 39462032 missense probably benign 0.00
R4515:Olfr954 UTSW 9 39462231 nonsense probably null
R4961:Olfr954 UTSW 9 39461887 missense probably damaging 1.00
R5219:Olfr954 UTSW 9 39462267 missense probably benign 0.09
R5602:Olfr954 UTSW 9 39462030 missense probably benign 0.00
R5887:Olfr954 UTSW 9 39461491 missense probably damaging 1.00
R5950:Olfr954 UTSW 9 39462337 missense probably benign 0.01
R6943:Olfr954 UTSW 9 39461863 missense probably benign 0.05
R7567:Olfr954 UTSW 9 39461877 missense possibly damaging 0.92
R8817:Olfr954 UTSW 9 39462091 missense probably damaging 1.00
X0060:Olfr954 UTSW 9 39462274 missense probably damaging 1.00
Z1177:Olfr954 UTSW 9 39461701 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACACACCCATGTACTATTTCCTCAG -3'
(R):5'- GCATGCAAGTTTCAAGAGGG -3'

Sequencing Primer
(F):5'- GTCCACAGTTGTTACCCCTAAAATG -3'
(R):5'- TTTCAAGAGGGGAAGGAAATCAC -3'
Posted On2015-12-29