Incidental Mutation 'R0412:Ppp6r1'
ID36712
Institutional Source Beutler Lab
Gene Symbol Ppp6r1
Ensembl Gene ENSMUSG00000052296
Gene Nameprotein phosphatase 6, regulatory subunit 1
SynonymsB430201G11Rik, Saps1, 2010309P17Rik, Pp6r1
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0412 (G1)
Quality Score206
Status Validated
Chromosome7
Chromosomal Location4631495-4659019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4642214 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 228 (I228T)
Ref Sequence ENSEMBL: ENSMUSP00000145575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064099] [ENSMUST00000205374] [ENSMUST00000206532]
Predicted Effect probably damaging
Transcript: ENSMUST00000064099
AA Change: I218T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066736
Gene: ENSMUSG00000052296
AA Change: I218T

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:SAPS 128 378 4.6e-69 PFAM
Pfam:SAPS 372 519 1.8e-39 PFAM
low complexity region 525 536 N/A INTRINSIC
low complexity region 618 639 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 842 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206391
Predicted Effect probably damaging
Transcript: ENSMUST00000206532
AA Change: I228T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206768
Predicted Effect unknown
Transcript: ENSMUST00000206966
AA Change: I79T
Meta Mutation Damage Score 0.9066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Ppp6r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Ppp6r1 APN 7 4639987 splice site probably null
IGL02232:Ppp6r1 APN 7 4633342 missense probably damaging 0.98
IGL02674:Ppp6r1 APN 7 4646813 missense probably damaging 1.00
IGL02887:Ppp6r1 APN 7 4642212 missense probably damaging 1.00
IGL02990:Ppp6r1 APN 7 4643023 missense possibly damaging 0.83
IGL03135:Ppp6r1 APN 7 4642160 missense possibly damaging 0.90
IGL03399:Ppp6r1 APN 7 4643252 missense probably damaging 1.00
R0375:Ppp6r1 UTSW 7 4633287 missense probably benign 0.00
R0760:Ppp6r1 UTSW 7 4639723 missense probably benign 0.00
R0883:Ppp6r1 UTSW 7 4639710 missense possibly damaging 0.89
R1478:Ppp6r1 UTSW 7 4640378 splice site probably null
R1515:Ppp6r1 UTSW 7 4643258 missense probably damaging 0.97
R1768:Ppp6r1 UTSW 7 4633692 critical splice donor site probably null
R1772:Ppp6r1 UTSW 7 4642031 missense probably benign 0.00
R4017:Ppp6r1 UTSW 7 4633744 missense probably benign 0.07
R4519:Ppp6r1 UTSW 7 4641046 unclassified probably null
R4795:Ppp6r1 UTSW 7 4641054 missense possibly damaging 0.66
R4849:Ppp6r1 UTSW 7 4643207 missense probably damaging 1.00
R5214:Ppp6r1 UTSW 7 4643177 missense probably benign 0.00
R5416:Ppp6r1 UTSW 7 4639748 missense possibly damaging 0.96
R5643:Ppp6r1 UTSW 7 4633772 missense probably benign 0.30
R5765:Ppp6r1 UTSW 7 4642208 missense possibly damaging 0.67
R6126:Ppp6r1 UTSW 7 4643377 missense possibly damaging 0.48
R6854:Ppp6r1 UTSW 7 4632396 missense probably benign 0.02
R6932:Ppp6r1 UTSW 7 4633292 missense possibly damaging 0.84
R7011:Ppp6r1 UTSW 7 4646826 missense probably damaging 1.00
R7486:Ppp6r1 UTSW 7 4639900 missense probably benign 0.17
R7500:Ppp6r1 UTSW 7 4636130 missense probably benign 0.04
X0062:Ppp6r1 UTSW 7 4640307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGACAGACTGGCACTGCTCTCC -3'
(R):5'- GCACACATGAGCGTCTCTTTTCTTG -3'

Sequencing Primer
(F):5'- ACATGTTACTGAGGAGCTGC -3'
(R):5'- GAGGTTTTGGGTACGAGCTTTC -3'
Posted On2013-05-09