Incidental Mutation 'R4786:Lama1'
ID 367135
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Name laminin, alpha 1
Synonyms Lama
MMRRC Submission 041995-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4786 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 67697265-67822645 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67773859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1294 (V1294E)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035471
AA Change: V1294E

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: V1294E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,536 I134N possibly damaging Het
Acvr1c T C 2: 58,280,354 Y414C probably damaging Het
Adam32 A C 8: 24,863,493 S693R probably damaging Het
Aldh2 A T 5: 121,572,824 F314Y probably benign Het
Anks1 A G 17: 28,052,730 D874G possibly damaging Het
Ap4b1 T A 3: 103,818,804 V372E probably benign Het
Aqp12 G A 1: 93,006,455 C18Y probably damaging Het
Arap1 T A 7: 101,385,005 I218N possibly damaging Het
Arhgap42 C A 9: 9,238,698 E28* probably null Het
Asb5 G A 8: 54,585,839 E247K probably benign Het
Atg9b T C 5: 24,386,089 D781G possibly damaging Het
Atxn10 A G 15: 85,387,143 H294R probably benign Het
Bod1l G T 5: 41,819,438 T1511K probably benign Het
Btnl2 A T 17: 34,363,348 N296I probably damaging Het
Camta1 A T 4: 151,290,039 L168H probably damaging Het
Cant1 A T 11: 118,408,839 V265E possibly damaging Het
Ccdc157 T C 11: 4,151,861 D20G probably damaging Het
Cd209c T G 8: 3,945,698 T35P possibly damaging Het
Cdc20b G A 13: 113,078,734 V279M probably damaging Het
Cdh18 T A 15: 23,410,787 W453R probably null Het
Cdh24 A G 14: 54,637,550 S333P possibly damaging Het
Ceacam11 T C 7: 17,972,314 probably null Het
Ciz1 C T 2: 32,377,527 P150L probably damaging Het
Crip3 C A 17: 46,431,042 Q152K possibly damaging Het
Dars2 G A 1: 161,060,760 R197W probably damaging Het
Dctn4 A G 18: 60,555,195 D394G probably damaging Het
Dido1 T C 2: 180,670,871 Y1077C possibly damaging Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egln3 A T 12: 54,185,581 I146N probably damaging Het
Eif2ak3 C T 6: 70,892,618 T763M possibly damaging Het
Etfbkmt A T 6: 149,147,246 M1L probably benign Het
Fam171a1 A T 2: 3,225,578 I583F probably damaging Het
Fbxo38 A C 18: 62,529,674 L249W probably damaging Het
Fxyd5 T C 7: 31,041,482 probably benign Het
Gabrr3 C A 16: 59,430,100 T154K probably benign Het
Gm7233 C A 14: 43,180,890 D90E probably benign Het
Gm8186 A G 17: 26,099,040 V61A probably benign Het
Gm9573 A T 17: 35,619,329 probably benign Het
Gnao1 A G 8: 93,944,303 I137V probably benign Het
Gnptab A G 10: 88,436,182 M945V probably damaging Het
Gpsm1 G A 2: 26,322,481 A78T probably benign Het
Gtf2b T C 3: 142,781,469 L222P probably damaging Het
Hnrnpf A G 6: 117,923,896 Y47C probably damaging Het
Itga6 A G 2: 71,838,690 N608S possibly damaging Het
Kdm2b T C 5: 122,880,854 probably null Het
Krit1 T A 5: 3,812,467 H207Q possibly damaging Het
Ky A G 9: 102,541,987 N398D probably benign Het
Lef1 C T 3: 131,111,524 T18I probably damaging Het
Lrp2 T C 2: 69,537,956 N178S probably damaging Het
Lrrc36 A G 8: 105,455,278 T525A probably benign Het
Map3k8 A T 18: 4,340,647 C222* probably null Het
Mapre2 G C 18: 23,877,959 S199T probably benign Het
Mcm3ap A G 10: 76,488,466 N911S probably benign Het
Mroh4 G T 15: 74,610,234 H722Q probably benign Het
Myo5b A C 18: 74,695,380 Y701S probably benign Het
Myt1l G T 12: 29,811,458 V80L unknown Het
Ncoa7 C A 10: 30,655,642 V24L probably benign Het
Nlrp10 A T 7: 108,925,238 V345D probably damaging Het
Nmral1 C A 16: 4,716,424 G51V probably damaging Het
Npc1 A G 18: 12,199,497 I797T probably benign Het
Olfr1269 A T 2: 90,119,007 I197N possibly damaging Het
Olfr936 T A 9: 39,047,487 R22* probably null Het
Olfr954 A T 9: 39,461,841 I134L probably benign Het
Pclo A T 5: 14,723,267 I4419F unknown Het
Phf3 C A 1: 30,816,557 E983* probably null Het
Pitpnm2 A T 5: 124,121,743 Y1149* probably null Het
Sdc3 A T 4: 130,822,768 T430S probably damaging Het
Sema3f A G 9: 107,682,682 V671A probably benign Het
Sigirr T G 7: 141,091,433 S379R probably benign Het
Slc25a23 T A 17: 57,047,326 N360I possibly damaging Het
Slco6c1 A T 1: 97,087,995 M357K probably benign Het
Sox14 C A 9: 99,874,965 M240I probably benign Het
Stradb A T 1: 58,991,208 probably benign Het
Szt2 A T 4: 118,399,062 M200K probably benign Het
Tef T C 15: 81,815,252 S85P probably benign Het
Thada T A 17: 84,458,855 H41L possibly damaging Het
Tinagl1 A G 4: 130,173,931 F90S probably benign Het
Tnfaip1 G A 11: 78,530,219 T5I possibly damaging Het
Tnfrsf23 A T 7: 143,680,064 V59D probably damaging Het
Tnpo3 A G 6: 29,578,542 V311A probably benign Het
Trak1 T A 9: 121,472,494 M772K probably benign Het
Ubash3a A G 17: 31,217,964 D185G probably benign Het
Vmn2r120 T C 17: 57,522,048 T516A probably benign Het
Wdr4 A C 17: 31,509,811 L130R probably damaging Het
Zfp12 T C 5: 143,245,502 I528T probably damaging Het
Zfp607a T C 7: 27,879,413 L636P probably damaging Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 67815928 missense probably benign
IGL00336:Lama1 APN 17 67813948 missense probably benign 0.07
IGL01066:Lama1 APN 17 67743326 missense probably damaging 1.00
IGL01140:Lama1 APN 17 67802933 missense probably benign 0.14
IGL01291:Lama1 APN 17 67738870 missense probably damaging 1.00
IGL01296:Lama1 APN 17 67745051 missense probably benign 0.27
IGL01317:Lama1 APN 17 67818701 missense probably damaging 1.00
IGL01490:Lama1 APN 17 67750584 missense possibly damaging 0.54
IGL01506:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01508:Lama1 APN 17 67809361 splice site probably benign
IGL01522:Lama1 APN 17 67752774 splice site probably benign
IGL01530:Lama1 APN 17 67796790 missense probably benign 0.02
IGL01541:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01677:Lama1 APN 17 67779148 missense probably benign 0.15
IGL01886:Lama1 APN 17 67807797 missense probably benign 0.36
IGL01994:Lama1 APN 17 67752439 missense probably benign 0.05
IGL02017:Lama1 APN 17 67764725 missense probably benign 0.00
IGL02021:Lama1 APN 17 67821626 missense probably damaging 1.00
IGL02026:Lama1 APN 17 67809292 missense possibly damaging 0.82
IGL02044:Lama1 APN 17 67811490 missense probably benign 0.01
IGL02120:Lama1 APN 17 67716789 missense probably damaging 1.00
IGL02425:Lama1 APN 17 67811485 missense probably benign 0.45
IGL02549:Lama1 APN 17 67790835 missense possibly damaging 0.93
IGL02642:Lama1 APN 17 67812366 missense probably benign 0.00
IGL02795:Lama1 APN 17 67738894 splice site probably null
IGL02798:Lama1 APN 17 67795191 splice site probably benign
IGL02863:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02870:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02876:Lama1 APN 17 67750692 critical splice donor site probably null
IGL02885:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02891:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02978:Lama1 APN 17 67786081 nonsense probably null
IGL03064:Lama1 APN 17 67779104 missense probably benign 0.01
IGL03076:Lama1 APN 17 67716799 missense possibly damaging 0.95
IGL03110:Lama1 APN 17 67798986 missense probably benign 0.04
IGL03143:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03159:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03268:Lama1 APN 17 67804536 missense probably damaging 0.99
ANU05:Lama1 UTSW 17 67738870 missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 67764704 missense
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0050:Lama1 UTSW 17 67782056 missense possibly damaging 0.66
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0111:Lama1 UTSW 17 67737498 missense probably damaging 0.98
R0116:Lama1 UTSW 17 67776923 missense probably benign 0.10
R0121:Lama1 UTSW 17 67798513 splice site probably benign
R0278:Lama1 UTSW 17 67810183 missense probably null 0.98
R0281:Lama1 UTSW 17 67817569 missense probably damaging 1.00
R0312:Lama1 UTSW 17 67775851 missense possibly damaging 0.45
R0419:Lama1 UTSW 17 67791610 critical splice donor site probably null
R0512:Lama1 UTSW 17 67779134 missense possibly damaging 0.67
R0514:Lama1 UTSW 17 67764698 missense probably benign 0.40
R0562:Lama1 UTSW 17 67815959 missense probably damaging 1.00
R0632:Lama1 UTSW 17 67752368 splice site probably benign
R0645:Lama1 UTSW 17 67773712 missense probably benign 0.01
R0712:Lama1 UTSW 17 67779042 splice site probably null
R0763:Lama1 UTSW 17 67772818 missense probably damaging 0.97
R0941:Lama1 UTSW 17 67775865 missense probably benign 0.10
R1025:Lama1 UTSW 17 67752898 missense probably benign 0.00
R1084:Lama1 UTSW 17 67804469 missense probably benign 0.12
R1103:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1420:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1430:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R1569:Lama1 UTSW 17 67780618 splice site probably null
R1575:Lama1 UTSW 17 67810409 missense possibly damaging 0.96
R1613:Lama1 UTSW 17 67807923 missense probably benign 0.42
R1620:Lama1 UTSW 17 67767033 missense probably benign 0.01
R1629:Lama1 UTSW 17 67805428 missense probably benign 0.00
R1645:Lama1 UTSW 17 67737682 missense probably benign 0.14
R1652:Lama1 UTSW 17 67807846 missense probably damaging 0.97
R1674:Lama1 UTSW 17 67791244 missense probably benign
R1678:Lama1 UTSW 17 67810155 missense possibly damaging 0.56
R1710:Lama1 UTSW 17 67753791 missense probably benign 0.00
R1712:Lama1 UTSW 17 67717186 missense possibly damaging 0.95
R1737:Lama1 UTSW 17 67802921 missense probably benign 0.36
R1757:Lama1 UTSW 17 67763836 missense probably benign 0.40
R1757:Lama1 UTSW 17 67697383 missense unknown
R1813:Lama1 UTSW 17 67791223 missense probably benign
R1896:Lama1 UTSW 17 67791223 missense probably benign
R1945:Lama1 UTSW 17 67745853 missense probably benign 0.14
R2086:Lama1 UTSW 17 67817623 missense probably damaging 1.00
R2149:Lama1 UTSW 17 67773865 missense possibly damaging 0.95
R2178:Lama1 UTSW 17 67769515 missense probably benign 0.07
R2183:Lama1 UTSW 17 67791009 missense probably damaging 0.98
R2197:Lama1 UTSW 17 67752941 missense probably benign 0.02
R2213:Lama1 UTSW 17 67777034 nonsense probably null
R2260:Lama1 UTSW 17 67737507 missense probably damaging 0.96
R2356:Lama1 UTSW 17 67810114 missense probably damaging 1.00
R2420:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2421:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2422:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2424:Lama1 UTSW 17 67798665 missense probably benign 0.09
R2442:Lama1 UTSW 17 67768317 missense probably benign 0.04
R3147:Lama1 UTSW 17 67737658 missense probably damaging 0.98
R3414:Lama1 UTSW 17 67737603 missense probably damaging 1.00
R3683:Lama1 UTSW 17 67768333 missense probably benign 0.40
R3820:Lama1 UTSW 17 67779046 splice site probably null
R3821:Lama1 UTSW 17 67779046 splice site probably null
R3822:Lama1 UTSW 17 67779046 splice site probably null
R4012:Lama1 UTSW 17 67812373 nonsense probably null
R4113:Lama1 UTSW 17 67764703 missense probably benign 0.01
R4133:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R4133:Lama1 UTSW 17 67812486 missense probably damaging 1.00
R4259:Lama1 UTSW 17 67752418 missense possibly damaging 0.95
R4278:Lama1 UTSW 17 67791517 missense probably null 0.00
R4321:Lama1 UTSW 17 67771083 missense probably benign 0.03
R4374:Lama1 UTSW 17 67804518 missense probably benign 0.00
R4386:Lama1 UTSW 17 67773712 missense probably benign 0.01
R4463:Lama1 UTSW 17 67761700 missense probably damaging 1.00
R4629:Lama1 UTSW 17 67805360 critical splice acceptor site probably null
R4630:Lama1 UTSW 17 67794300 missense probably benign 0.00
R4633:Lama1 UTSW 17 67798584 missense probably damaging 0.96
R4668:Lama1 UTSW 17 67752434 missense probably benign 0.27
R4684:Lama1 UTSW 17 67773778 missense possibly damaging 0.88
R4745:Lama1 UTSW 17 67738780 missense probably damaging 1.00
R4797:Lama1 UTSW 17 67716775 missense probably benign 0.04
R4803:Lama1 UTSW 17 67809271 missense probably damaging 1.00
R4925:Lama1 UTSW 17 67794314 missense probably benign 0.02
R4939:Lama1 UTSW 17 67737475 missense possibly damaging 0.91
R4952:Lama1 UTSW 17 67767566 critical splice donor site probably null
R4975:Lama1 UTSW 17 67738834 missense possibly damaging 0.95
R4977:Lama1 UTSW 17 67737682 missense probably damaging 1.00
R5039:Lama1 UTSW 17 67745893 missense possibly damaging 0.66
R5047:Lama1 UTSW 17 67743281 nonsense probably null
R5195:Lama1 UTSW 17 67764800 missense probably benign 0.13
R5230:Lama1 UTSW 17 67745083 nonsense probably null
R5236:Lama1 UTSW 17 67804492 missense probably benign 0.24
R5254:Lama1 UTSW 17 67756716 missense probably benign 0.01
R5345:Lama1 UTSW 17 67817563 missense probably benign
R5438:Lama1 UTSW 17 67800774 missense possibly damaging 0.92
R5521:Lama1 UTSW 17 67780894 nonsense probably null
R5568:Lama1 UTSW 17 67768298 critical splice acceptor site probably null
R5645:Lama1 UTSW 17 67802948 missense probably damaging 1.00
R5665:Lama1 UTSW 17 67770987 missense probably damaging 1.00
R5727:Lama1 UTSW 17 67815224 missense possibly damaging 0.81
R5757:Lama1 UTSW 17 67738787 missense possibly damaging 0.59
R5795:Lama1 UTSW 17 67796727 missense probably benign 0.02
R5857:Lama1 UTSW 17 67807843 missense probably damaging 0.99
R5894:Lama1 UTSW 17 67779047 critical splice acceptor site probably null
R5974:Lama1 UTSW 17 67773727 missense probably benign 0.31
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6120:Lama1 UTSW 17 67780617 critical splice donor site probably null
R6219:Lama1 UTSW 17 67790856 missense probably benign 0.08
R6224:Lama1 UTSW 17 67802987 missense possibly damaging 0.56
R6249:Lama1 UTSW 17 67798604 missense probably benign
R6265:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R6276:Lama1 UTSW 17 67784088 splice site probably null
R6284:Lama1 UTSW 17 67810096 missense probably damaging 0.99
R6337:Lama1 UTSW 17 67786019 missense probably benign 0.27
R6414:Lama1 UTSW 17 67746910 critical splice donor site probably null
R6631:Lama1 UTSW 17 67774482 missense probably benign 0.21
R6659:Lama1 UTSW 17 67818635 missense probably damaging 1.00
R6660:Lama1 UTSW 17 67804500 missense probably benign 0.05
R6677:Lama1 UTSW 17 67795233 missense probably benign 0.14
R6763:Lama1 UTSW 17 67746873 missense unknown
R6787:Lama1 UTSW 17 67784025 missense unknown
R6831:Lama1 UTSW 17 67756754 missense possibly damaging 0.89
R6855:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R6910:Lama1 UTSW 17 67791464 missense possibly damaging 0.60
R6934:Lama1 UTSW 17 67774543 missense probably benign 0.04
R6945:Lama1 UTSW 17 67813866 missense
R6984:Lama1 UTSW 17 67779112 missense
R6989:Lama1 UTSW 17 67753758 missense
R6994:Lama1 UTSW 17 67753825 missense
R6995:Lama1 UTSW 17 67753825 missense
R7035:Lama1 UTSW 17 67781049 missense
R7133:Lama1 UTSW 17 67782146 missense
R7172:Lama1 UTSW 17 67804545 missense
R7197:Lama1 UTSW 17 67737705 nonsense probably null
R7217:Lama1 UTSW 17 67764673 missense
R7229:Lama1 UTSW 17 67752446 missense
R7264:Lama1 UTSW 17 67743297 missense
R7311:Lama1 UTSW 17 67767385 missense
R7394:Lama1 UTSW 17 67717261 missense
R7419:Lama1 UTSW 17 67717174 missense
R7460:Lama1 UTSW 17 67767018 missense
R7492:Lama1 UTSW 17 67817651 missense
R7494:Lama1 UTSW 17 67811446 missense
R7552:Lama1 UTSW 17 67737667 missense
R7576:Lama1 UTSW 17 67782041 missense
R7583:Lama1 UTSW 17 67761621 missense
R7649:Lama1 UTSW 17 67737554 missense
R7663:Lama1 UTSW 17 67780880 missense
R7667:Lama1 UTSW 17 67780597 missense
R7688:Lama1 UTSW 17 67761628 missense
R7693:Lama1 UTSW 17 67817031 missense
R7748:Lama1 UTSW 17 67750590 missense
R7778:Lama1 UTSW 17 67804473 missense
R7824:Lama1 UTSW 17 67804473 missense
R7861:Lama1 UTSW 17 67809221 missense
R7884:Lama1 UTSW 17 67769435 missense
R8029:Lama1 UTSW 17 67817594 missense
R8078:Lama1 UTSW 17 67791294 missense
R8101:Lama1 UTSW 17 67745922 missense
R8313:Lama1 UTSW 17 67750520 missense
R8356:Lama1 UTSW 17 67737496 missense
R8366:Lama1 UTSW 17 67818704 missense
R8403:Lama1 UTSW 17 67745923 missense
R8456:Lama1 UTSW 17 67737496 missense
R8466:Lama1 UTSW 17 67813953 missense
R8678:Lama1 UTSW 17 67817103 missense
R8728:Lama1 UTSW 17 67818668 missense
R8796:Lama1 UTSW 17 67810151 missense
R8885:Lama1 UTSW 17 67773784 missense
R8893:Lama1 UTSW 17 67805372 missense
R8898:Lama1 UTSW 17 67821615 missense
R8909:Lama1 UTSW 17 67772741 missense
R9025:Lama1 UTSW 17 67812496 missense
R9045:Lama1 UTSW 17 67753843 missense
R9098:Lama1 UTSW 17 67804513 missense
R9114:Lama1 UTSW 17 67821674 missense
R9173:Lama1 UTSW 17 67769602 missense
R9190:Lama1 UTSW 17 67804519 missense
R9381:Lama1 UTSW 17 67737484 missense
R9429:Lama1 UTSW 17 67811454 missense
R9504:Lama1 UTSW 17 67821666 missense
R9558:Lama1 UTSW 17 67817009 missense
R9647:Lama1 UTSW 17 67717175 missense
R9651:Lama1 UTSW 17 67794220 missense
R9654:Lama1 UTSW 17 67794271 missense
R9710:Lama1 UTSW 17 67822409 missense
R9733:Lama1 UTSW 17 67809945 missense
RF001:Lama1 UTSW 17 67752902 missense
RF013:Lama1 UTSW 17 67781062 missense
V8831:Lama1 UTSW 17 67752883 missense probably benign 0.00
X0024:Lama1 UTSW 17 67738888 missense probably damaging 1.00
X0028:Lama1 UTSW 17 67767422 missense probably benign 0.00
X0028:Lama1 UTSW 17 67794310 missense probably benign 0.06
X0066:Lama1 UTSW 17 67811566 missense probably damaging 1.00
Z1088:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1088:Lama1 UTSW 17 67771082 missense probably benign 0.25
Z1088:Lama1 UTSW 17 67810171 missense probably damaging 1.00
Z1176:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1177:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1191:Lama1 UTSW 17 67798644 missense
Predicted Primers PCR Primer
(F):5'- GGCTTATGGTGGGAAACTCC -3'
(R):5'- TCAGGTGACTTAACATCCAACTC -3'

Sequencing Primer
(F):5'- GAAACTCCAGTACAGTGTGGCTTTC -3'
(R):5'- AAACAGCTACTGTCGTTTGGC -3'
Posted On 2015-12-29