Mutagenetix > Incidental Mutations

Incidental Mutation 'R4787:Smap1'

367143

Institutional Source

Beutler Lab

Gene Symbol

Smap1

Ensembl Gene

ENSMUSG00000026155

Gene Name

small ArfGAP 1

Synonyms

4921525H11Rik, 4921514B13Rik, 1700056O10Rik

MMRRC Submission

041975-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R4787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23844846-23922317 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to T at 23849266 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027339] [ENSMUST00000063663] [ENSMUST00000129254]

Predicted Effect

probably benign
Transcript: ENSMUST00000027339

SMART Domains

Protein: ENSMUSP00000027339
Gene: ENSMUSG00000026155

Domain	Start	End	E-Value	Type
ArfGap	19	136	1.12e-45	SMART
low complexity region	137	178	N/A	INTRINSIC
low complexity region	361	379	N/A	INTRINSIC
low complexity region	401	413	N/A	INTRINSIC
low complexity region	420	439	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063663

SMART Domains

Protein: ENSMUSP00000066582
Gene: ENSMUSG00000026156

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Glyco_transf_43	102	305	1.1e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129254

SMART Domains

Protein: ENSMUSP00000117875
Gene: ENSMUSG00000026155

Domain	Start	End	E-Value	Type
SCOP:d1dcqa2	1	47	1e-11	SMART
Blast:ArfGap	1	51	2e-18	BLAST
PDB:2CRR\|A	1	51	1e-19	PDB
low complexity region	52	93	N/A	INTRINSIC
low complexity region	276	294	N/A	INTRINSIC
low complexity region	316	328	N/A	INTRINSIC
low complexity region	335	354	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133398

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136506

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149737

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the mouse stromal membrane-associated protein-1. This similarity suggests that this human gene product is also a type II membrane glycoprotein involved in the erythropoietic stimulatory activity of stromal cells. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perturbed receptor trafficking and myelodysplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	C	A	8: 72,445,164	Y138*	probably null	Het
4933440M02Rik	T	C	7: 125,331,542		noncoding transcript	Het
Amy2b	T	C	3: 113,151,318		noncoding transcript	Het
Anxa1	T	A	19: 20,373,754	D334V	probably damaging	Het
Atoh8	T	C	6: 72,223,777	T310A	possibly damaging	Het
BC002059	G	A	17: 16,973,548		noncoding transcript	Het
C87499	T	A	4: 88,629,213	K74*	probably null	Het
Ccdc40	A	G	11: 119,253,621	D924G	possibly damaging	Het
Ccm2l	A	T	2: 153,079,502	M433L	probably benign	Het
Cd209e	T	C	8: 3,851,181	S158G	probably null	Het
Cdkn2a	C	T	4: 89,276,718	R153H	unknown	Het
Cfap69	A	G	5: 5,646,934		probably null	Het
Col6a5	T	C	9: 105,931,081	T923A	unknown	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Ddrgk1	A	G	2: 130,658,328	F216S	probably damaging	Het
Dysf	T	A	6: 84,203,328	C1995*	probably null	Het
Epb41l5	G	A	1: 119,595,995	P467S	probably benign	Het
Extl1	G	A	4: 134,364,667	L292F	probably damaging	Het
Fsd1	A	G	17: 55,996,257	N409D	possibly damaging	Het
Gm15455	A	T	1: 33,837,722		noncoding transcript	Het
Gm5514	C	A	19: 21,938,237		noncoding transcript	Het
Gm8894	A	G	14: 55,420,715		noncoding transcript	Het
Gm8979	T	C	7: 106,081,834		noncoding transcript	Het
Gtf3c2	C	T	5: 31,157,577	S942N	probably benign	Het
H2-Ab1	A	T	17: 34,267,467	T167S	possibly damaging	Het
Ighv8-9	C	T	12: 115,468,514	R59H	probably damaging	Het
Igsf9b	G	A	9: 27,317,456	V171I	probably benign	Het
Il31ra	C	T	13: 112,527,545	E533K	possibly damaging	Het
Iqgap1	A	C	7: 80,735,513	L1022R	probably damaging	Het
Kcna4	T	C	2: 107,296,468	F516L	probably damaging	Het
Kmt2e	A	G	5: 23,463,083	T47A	possibly damaging	Het
L3mbtl2	A	G	15: 81,663,974		probably benign	Het
Lipo1	T	A	19: 33,780,349	Q240L	probably benign	Het
Lpar5	A	G	6: 125,082,498		probably null	Het
Lrrk2	A	G	15: 91,712,828	D541G	probably benign	Het
Med9	T	A	11: 59,948,440	N58K	probably benign	Het
Meig1	A	G	2: 3,409,214	V83A	possibly damaging	Het
Natd1	A	C	11: 60,906,996	C34W	probably damaging	Het
Nup205	T	A	6: 35,202,061	C689S	probably damaging	Het
Olfr1161	T	C	2: 88,024,860	M46T	possibly damaging	Het
Olfr1199	T	A	2: 88,755,875	K267*	probably null	Het
Olfr2	G	A	7: 107,001,086	A258V	probably benign	Het
Olfr654	T	C	7: 104,587,960	M52T	probably benign	Het
Pdgfrb	A	C	18: 61,079,687	S888R	probably damaging	Het
Plppr4	T	C	3: 117,322,330	E626G	probably damaging	Het
Ppfia3	C	A	7: 45,340,626	A1159S	possibly damaging	Het
Prex1	A	G	2: 166,638,340	V160A	probably benign	Het
Psmb7	C	T	2: 38,588,271	C247Y	probably benign	Het
Rbm33	C	T	5: 28,342,437		probably null	Het
Rfc5	T	C	5: 117,382,420	T236A	probably benign	Het
Sdk1	G	T	5: 141,582,413	R122L	probably benign	Het
Sh3bp1	T	C	15: 78,907,995	S451P	possibly damaging	Het
Smc2	T	A	4: 52,462,927	V639E	probably damaging	Het
Synpo2l	T	A	14: 20,661,697	Q511L	possibly damaging	Het
Taok2	G	A	7: 126,868,132	S167L	possibly damaging	Het
Tbc1d17	G	A	7: 44,843,064	P392S	probably benign	Het
Tef	T	A	15: 81,823,557	I261N	probably damaging	Het
Tmbim1	T	C	1: 74,295,360	N14D	possibly damaging	Het
Tmprss11c	T	C	5: 86,256,453	K121R	probably benign	Het
Trim36	C	A	18: 46,172,532	M461I	probably benign	Het
Trpc1	T	A	9: 95,721,415	M355L	probably benign	Het
Tspyl4	A	C	10: 34,297,764	D84A	probably benign	Het
Twf1	G	T	15: 94,584,434	P144T	probably damaging	Het
Ugt1a7c	T	C	1: 88,095,670	C184R	probably damaging	Het
Unc79	C	T	12: 103,046,998	P283S	probably damaging	Het
Usp45	T	C	4: 21,796,860	C49R	probably benign	Het
Wdr11	T	A	7: 129,608,934		probably benign	Het
Wdr27	A	T	17: 14,932,554	M97K	possibly damaging	Het

Other mutations in Smap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Smap1	APN	1	23848274	missense	probably benign	0.00
IGL02182:Smap1	APN	1	23859099	missense	probably damaging	0.99
IGL02869:Smap1	APN	1	23891914	missense	possibly damaging	0.87
R0308:Smap1	UTSW	1	23849342	missense	probably damaging	1.00
R0647:Smap1	UTSW	1	23853478	missense	probably damaging	1.00
R2107:Smap1	UTSW	1	23848454	missense	possibly damaging	0.88
R2235:Smap1	UTSW	1	23859058	missense	probably benign	0.04
R3153:Smap1	UTSW	1	23853549	missense	probably damaging	1.00
R4166:Smap1	UTSW	1	23848425	missense	probably benign	0.00
R4780:Smap1	UTSW	1	23853436	missense	probably benign	0.11
R5426:Smap1	UTSW	1	23849390	missense	probably benign	0.11
R7623:Smap1	UTSW	1	23848295	missense	probably benign	0.39
R7662:Smap1	UTSW	1	23877774	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAATCCAGTTAATTCCTGAACTC -3'
(R):5'- CCTGTCTACCGTTACATCTGGG -3'

Sequencing Primer
(F):5'- CCTGAACTCCTGTCTTATAAACTTG -3'
(R):5'- GGACCTGGATCTGTTTACTGAGC -3'

Posted On

2015-12-29