Incidental Mutation 'R4787:Meig1'
ID367148
Institutional Source Beutler Lab
Gene Symbol Meig1
Ensembl Gene ENSMUSG00000026650
Gene Namemeiosis expressed gene 1
SynonymsMeg1
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3409043-3422648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3409214 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000110736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064685] [ENSMUST00000115081] [ENSMUST00000115082] [ENSMUST00000115083] [ENSMUST00000115084] [ENSMUST00000144584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064685
AA Change: V83A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070310
Gene: ENSMUSG00000026650
AA Change: V83A

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115081
AA Change: V83A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110733
Gene: ENSMUSG00000026650
AA Change: V83A

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 86 6.3e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115082
AA Change: V83A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110734
Gene: ENSMUSG00000026650
AA Change: V83A

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115083
AA Change: V83A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110735
Gene: ENSMUSG00000026650
AA Change: V83A

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115084
AA Change: V83A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110736
Gene: ENSMUSG00000026650
AA Change: V83A

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144584
SMART Domains Protein: ENSMUSP00000123118
Gene: ENSMUSG00000026650

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 65 6.1e-29 PFAM
Meta Mutation Damage Score 0.2172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility with arrested spermatogenesis, absent sperm flagellum, and deformed sperm heads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Meig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Meig1 APN 2 3409274 missense probably damaging 1.00
IGL01311:Meig1 APN 2 3409208 missense possibly damaging 0.78
IGL02329:Meig1 APN 2 3409251 missense probably damaging 0.97
IGL02730:Meig1 APN 2 3411910 missense probably damaging 1.00
R1119:Meig1 UTSW 2 3409274 missense probably damaging 1.00
R1681:Meig1 UTSW 2 3409274 missense probably damaging 1.00
R2155:Meig1 UTSW 2 3409253 missense probably benign 0.08
R4387:Meig1 UTSW 2 3409241 missense probably damaging 1.00
R4814:Meig1 UTSW 2 3411922 missense probably benign 0.14
R5145:Meig1 UTSW 2 3409226 missense probably damaging 0.98
R5694:Meig1 UTSW 2 3411962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCAGATCCTAAGGTTCTCAG -3'
(R):5'- CAAATTGTCAGACGGTGAAACG -3'

Sequencing Primer
(F):5'- CAGATCCTAAGGTTCTCAGTAATTGC -3'
(R):5'- CGTGACGTAAAATCATACTAGCGTG -3'
Posted On2015-12-29