Incidental Mutation 'R4787:Olfr1199'
ID367151
Institutional Source Beutler Lab
Gene Symbol Olfr1199
Ensembl Gene ENSMUSG00000089892
Gene Nameolfactory receptor 1199
SynonymsMOR230-8, GA_x6K02T2Q125-50231574-50230642
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88754195-88760469 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 88755875 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 267 (K267*)
Ref Sequence ENSEMBL: ENSMUSP00000149809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099813] [ENSMUST00000124021] [ENSMUST00000131038] [ENSMUST00000213138] [ENSMUST00000215179] [ENSMUST00000215529]
Predicted Effect probably null
Transcript: ENSMUST00000099813
AA Change: K267*
SMART Domains Protein: ENSMUSP00000097401
Gene: ENSMUSG00000089892
AA Change: K267*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.4e-48 PFAM
Pfam:7tm_1 39 285 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124021
AA Change: K267*
Predicted Effect probably null
Transcript: ENSMUST00000131038
AA Change: K267*
Predicted Effect probably null
Transcript: ENSMUST00000213138
AA Change: K267*
Predicted Effect probably benign
Transcript: ENSMUST00000215179
Predicted Effect probably benign
Transcript: ENSMUST00000215529
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Olfr1199
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Olfr1199 APN 2 88756156 missense possibly damaging 0.83
IGL03197:Olfr1199 APN 2 88756201 missense probably damaging 0.99
R0282:Olfr1199 UTSW 2 88756456 missense probably damaging 1.00
R1564:Olfr1199 UTSW 2 88756656 missense possibly damaging 0.81
R1750:Olfr1199 UTSW 2 88755773 missense probably benign
R2139:Olfr1199 UTSW 2 88756093 missense probably damaging 1.00
R4059:Olfr1199 UTSW 2 88756451 missense probably benign
R4722:Olfr1199 UTSW 2 88756012 missense possibly damaging 0.47
R5595:Olfr1199 UTSW 2 88756405 missense probably damaging 0.97
R6522:Olfr1199 UTSW 2 88756108 missense probably damaging 0.99
R6825:Olfr1199 UTSW 2 88755911 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TAGTCCCCATTCCCTAAGAAACTG -3'
(R):5'- CACAGTGAGTTTCCTTGTGC -3'

Sequencing Primer
(F):5'- CCACAACTTCTTCATAGCAT -3'
(R):5'- CACAGTGAGTTTCCTTGTGCTAATG -3'
Posted On2015-12-29