Mutagenetix > Incidental Mutations

Incidental Mutation 'R4787:Prex1'

367155

Institutional Source

Beutler Lab

Gene Symbol

Prex1

Ensembl Gene

ENSMUSG00000039621

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1

Synonyms

P-REX1

MMRRC Submission

041975-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R4787 (G1)

Quality Score

126

Status

Validated

Chromosome

Chromosomal Location

166566342-166713832 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 166638340 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 160 (V160A)

Ref Sequence

ENSEMBL: ENSMUSP00000037180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]

Predicted Effect

probably benign
Transcript: ENSMUST00000036719
AA Change: V160A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: V160A

Domain	Start	End	E-Value	Type
low complexity region	3	27	N/A	INTRINSIC
RhoGEF	48	234	3.16e-52	SMART
PH	267	389	1.02e-10	SMART
DEP	418	491	6.86e-27	SMART
DEP	519	592	3.06e-24	SMART
PDZ	628	701	4.55e-1	SMART
PDZ	712	783	5.66e-1	SMART
low complexity region	800	811	N/A	INTRINSIC
low complexity region	814	825	N/A	INTRINSIC
low complexity region	1109	1127	N/A	INTRINSIC
low complexity region	1545	1555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099080

SMART Domains

Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	5	64	3.8e-18	PFAM
PH	97	219	1.02e-10	SMART
DEP	248	321	6.86e-27	SMART
DEP	349	422	3.06e-24	SMART
PDZ	458	531	4.55e-1	SMART
PDZ	542	613	5.66e-1	SMART
low complexity region	630	641	N/A	INTRINSIC
low complexity region	644	655	N/A	INTRINSIC
low complexity region	939	957	N/A	INTRINSIC
low complexity region	1375	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152238

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	C	A	8: 72,445,164	Y138*	probably null	Het
4933440M02Rik	T	C	7: 125,331,542		noncoding transcript	Het
Amy2b	T	C	3: 113,151,318		noncoding transcript	Het
Anxa1	T	A	19: 20,373,754	D334V	probably damaging	Het
Atoh8	T	C	6: 72,223,777	T310A	possibly damaging	Het
BC002059	G	A	17: 16,973,548		noncoding transcript	Het
C87499	T	A	4: 88,629,213	K74*	probably null	Het
Ccdc40	A	G	11: 119,253,621	D924G	possibly damaging	Het
Ccm2l	A	T	2: 153,079,502	M433L	probably benign	Het
Cd209e	T	C	8: 3,851,181	S158G	probably null	Het
Cdkn2a	C	T	4: 89,276,718	R153H	unknown	Het
Cfap69	A	G	5: 5,646,934		probably null	Het
Col6a5	T	C	9: 105,931,081	T923A	unknown	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Ddrgk1	A	G	2: 130,658,328	F216S	probably damaging	Het
Dysf	T	A	6: 84,203,328	C1995*	probably null	Het
Epb41l5	G	A	1: 119,595,995	P467S	probably benign	Het
Extl1	G	A	4: 134,364,667	L292F	probably damaging	Het
Fsd1	A	G	17: 55,996,257	N409D	possibly damaging	Het
Gm15455	A	T	1: 33,837,722		noncoding transcript	Het
Gm5514	C	A	19: 21,938,237		noncoding transcript	Het
Gm8894	A	G	14: 55,420,715		noncoding transcript	Het
Gm8979	T	C	7: 106,081,834		noncoding transcript	Het
Gtf3c2	C	T	5: 31,157,577	S942N	probably benign	Het
H2-Ab1	A	T	17: 34,267,467	T167S	possibly damaging	Het
Ighv8-9	C	T	12: 115,468,514	R59H	probably damaging	Het
Igsf9b	G	A	9: 27,317,456	V171I	probably benign	Het
Il31ra	C	T	13: 112,527,545	E533K	possibly damaging	Het
Iqgap1	A	C	7: 80,735,513	L1022R	probably damaging	Het
Kcna4	T	C	2: 107,296,468	F516L	probably damaging	Het
Kmt2e	A	G	5: 23,463,083	T47A	possibly damaging	Het
L3mbtl2	A	G	15: 81,663,974		probably benign	Het
Lipo1	T	A	19: 33,780,349	Q240L	probably benign	Het
Lpar5	A	G	6: 125,082,498		probably null	Het
Lrrk2	A	G	15: 91,712,828	D541G	probably benign	Het
Med9	T	A	11: 59,948,440	N58K	probably benign	Het
Meig1	A	G	2: 3,409,214	V83A	possibly damaging	Het
Natd1	A	C	11: 60,906,996	C34W	probably damaging	Het
Nup205	T	A	6: 35,202,061	C689S	probably damaging	Het
Olfr1161	T	C	2: 88,024,860	M46T	possibly damaging	Het
Olfr1199	T	A	2: 88,755,875	K267*	probably null	Het
Olfr2	G	A	7: 107,001,086	A258V	probably benign	Het
Olfr654	T	C	7: 104,587,960	M52T	probably benign	Het
Pdgfrb	A	C	18: 61,079,687	S888R	probably damaging	Het
Plppr4	T	C	3: 117,322,330	E626G	probably damaging	Het
Ppfia3	C	A	7: 45,340,626	A1159S	possibly damaging	Het
Psmb7	C	T	2: 38,588,271	C247Y	probably benign	Het
Rbm33	C	T	5: 28,342,437		probably null	Het
Rfc5	T	C	5: 117,382,420	T236A	probably benign	Het
Sdk1	G	T	5: 141,582,413	R122L	probably benign	Het
Sh3bp1	T	C	15: 78,907,995	S451P	possibly damaging	Het
Smap1	G	T	1: 23,849,266		probably benign	Het
Smc2	T	A	4: 52,462,927	V639E	probably damaging	Het
Synpo2l	T	A	14: 20,661,697	Q511L	possibly damaging	Het
Taok2	G	A	7: 126,868,132	S167L	possibly damaging	Het
Tbc1d17	G	A	7: 44,843,064	P392S	probably benign	Het
Tef	T	A	15: 81,823,557	I261N	probably damaging	Het
Tmbim1	T	C	1: 74,295,360	N14D	possibly damaging	Het
Tmprss11c	T	C	5: 86,256,453	K121R	probably benign	Het
Trim36	C	A	18: 46,172,532	M461I	probably benign	Het
Trpc1	T	A	9: 95,721,415	M355L	probably benign	Het
Tspyl4	A	C	10: 34,297,764	D84A	probably benign	Het
Twf1	G	T	15: 94,584,434	P144T	probably damaging	Het
Ugt1a7c	T	C	1: 88,095,670	C184R	probably damaging	Het
Unc79	C	T	12: 103,046,998	P283S	probably damaging	Het
Usp45	T	C	4: 21,796,860	C49R	probably benign	Het
Wdr11	T	A	7: 129,608,934		probably benign	Het
Wdr27	A	T	17: 14,932,554	M97K	possibly damaging	Het

Other mutations in Prex1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Prex1	APN	2	166638401	missense	probably damaging	1.00
IGL00309:Prex1	APN	2	166609823	missense	probably damaging	0.99
IGL00953:Prex1	APN	2	166638409	missense	probably damaging	1.00
IGL00961:Prex1	APN	2	166585736	missense	probably damaging	0.98
IGL01300:Prex1	APN	2	166638407	missense	possibly damaging	0.46
IGL01318:Prex1	APN	2	166569340	splice site	probably benign
IGL01753:Prex1	APN	2	166602882	missense	probably benign	0.11
IGL01819:Prex1	APN	2	166621245	missense	probably damaging	1.00
IGL02058:Prex1	APN	2	166585183	missense	probably benign	0.00
IGL02251:Prex1	APN	2	166577886	missense	probably damaging	0.99
IGL02326:Prex1	APN	2	166621185	missense	probably benign	0.35
IGL02366:Prex1	APN	2	166580427	missense	probably damaging	1.00
IGL02414:Prex1	APN	2	166609828	missense	probably damaging	1.00
IGL02660:Prex1	APN	2	166593867	missense	probably damaging	0.97
IGL02666:Prex1	APN	2	166572989	missense	probably benign	0.00
IGL02874:Prex1	APN	2	166585047	missense	probably damaging	1.00
IGL02935:Prex1	APN	2	166570345	missense	probably damaging	1.00
IGL03179:Prex1	APN	2	166585194	missense	probably benign	0.31
R0207:Prex1	UTSW	2	166585898	missense	possibly damaging	0.92
R0415:Prex1	UTSW	2	166586699	unclassified	probably benign
R0420:Prex1	UTSW	2	166589571	missense	probably benign	0.13
R0449:Prex1	UTSW	2	166569377	missense	probably benign	0.16
R0458:Prex1	UTSW	2	166585823	missense	probably damaging	0.99
R0927:Prex1	UTSW	2	166586537	missense	probably benign	0.01
R1299:Prex1	UTSW	2	166585907	missense	possibly damaging	0.62
R1414:Prex1	UTSW	2	166593861	missense	probably damaging	1.00
R1440:Prex1	UTSW	2	166580463	missense	probably damaging	0.98
R1506:Prex1	UTSW	2	166587081	missense	probably damaging	1.00
R1725:Prex1	UTSW	2	166601736	missense	probably damaging	1.00
R1831:Prex1	UTSW	2	166585101	missense	probably damaging	1.00
R1883:Prex1	UTSW	2	166583272	missense	probably benign	0.20
R1896:Prex1	UTSW	2	166586654	missense	probably benign	0.01
R2022:Prex1	UTSW	2	166575614	missense	possibly damaging	0.80
R2091:Prex1	UTSW	2	166569365	missense	possibly damaging	0.95
R2258:Prex1	UTSW	2	166587157	missense	probably benign	0.00
R2263:Prex1	UTSW	2	166589068	splice site	probably benign
R2276:Prex1	UTSW	2	166577955	missense	probably benign	0.34
R2279:Prex1	UTSW	2	166577955	missense	probably benign	0.34
R2680:Prex1	UTSW	2	166601772	missense	possibly damaging	0.92
R3024:Prex1	UTSW	2	166589036	missense	probably benign	0.04
R3421:Prex1	UTSW	2	166617854	missense	probably damaging	1.00
R3614:Prex1	UTSW	2	166609781	missense	probably damaging	1.00
R4244:Prex1	UTSW	2	166570336	missense	probably damaging	1.00
R4605:Prex1	UTSW	2	166713544	missense	probably benign	0.45
R4685:Prex1	UTSW	2	166638332	missense	probably damaging	0.97
R4796:Prex1	UTSW	2	166592291	missense	probably damaging	1.00
R4825:Prex1	UTSW	2	166585857	nonsense	probably null
R4955:Prex1	UTSW	2	166573223	missense	probably damaging	0.99
R5046:Prex1	UTSW	2	166572963	missense	probably benign	0.00
R5095:Prex1	UTSW	2	166581921	missense	probably damaging	1.00
R5408:Prex1	UTSW	2	166575653	small insertion	probably benign
R5462:Prex1	UTSW	2	166644808	missense	probably benign	0.02
R5535:Prex1	UTSW	2	166580273	missense	possibly damaging	0.80
R5777:Prex1	UTSW	2	166586659	missense	probably damaging	1.00
R5813:Prex1	UTSW	2	166583207	missense	probably benign
R5860:Prex1	UTSW	2	166644684	intron	probably benign
R5984:Prex1	UTSW	2	166585744	missense	probably damaging	1.00
R6009:Prex1	UTSW	2	166581984	missense	probably damaging	1.00
R6174:Prex1	UTSW	2	166572963	missense	probably benign	0.00
R6345:Prex1	UTSW	2	166572960	missense	probably null	0.81
R6897:Prex1	UTSW	2	166581993	missense	probably damaging	0.99
R6935:Prex1	UTSW	2	166599655	missense	probably damaging	1.00
R7025:Prex1	UTSW	2	166613187	small insertion	probably benign
R7037:Prex1	UTSW	2	166587180	missense	probably benign	0.05
R7076:Prex1	UTSW	2	166633382	missense	probably damaging	0.99
R7181:Prex1	UTSW	2	166570371	missense	probably damaging	1.00
R7361:Prex1	UTSW	2	166713570	missense	probably benign	0.04
R7381:Prex1	UTSW	2	166587127	missense	probably damaging	1.00
R7721:Prex1	UTSW	2	166577890	nonsense	probably null
R7763:Prex1	UTSW	2	166713709	missense	unknown
R7809:Prex1	UTSW	2	166573244	missense	possibly damaging	0.91
R7915:Prex1	UTSW	2	166621192	missense	probably damaging	1.00
R7971:Prex1	UTSW	2	166581939	missense	probably damaging	1.00
R7998:Prex1	UTSW	2	166587045	critical splice donor site	probably null
R8029:Prex1	UTSW	2	166575603	missense	probably benign	0.01
R8193:Prex1	UTSW	2	166593860	missense	possibly damaging	0.60
R8352:Prex1	UTSW	2	166589573	missense	probably benign	0.05
R8452:Prex1	UTSW	2	166589573	missense	probably benign	0.05
X0065:Prex1	UTSW	2	166586625	missense	probably benign
Z1176:Prex1	UTSW	2	166572970	nonsense	probably null
Z1177:Prex1	UTSW	2	166592228	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGGAATTATCACAGTGTGGGC -3'
(R):5'- TGGATCTCTTCATCGCGAGG -3'

Sequencing Primer
(F):5'- ATTATCACAGTGTGGGCTACAG -3'
(R):5'- TTCATCGCGAGGCCCGAG -3'

Posted On

2015-12-29