Incidental Mutation 'R4787:Prex1'
ID367155
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4787 (G1)
Quality Score126
Status Validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166638340 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 160 (V160A)
Ref Sequence ENSEMBL: ENSMUSP00000037180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]
Predicted Effect probably benign
Transcript: ENSMUST00000036719
AA Change: V160A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: V160A

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099080
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152238
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
R7721:Prex1 UTSW 2 166577890 nonsense probably null
R7763:Prex1 UTSW 2 166713709 missense unknown
R7809:Prex1 UTSW 2 166573244 missense possibly damaging 0.91
X0065:Prex1 UTSW 2 166586625 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAATTATCACAGTGTGGGC -3'
(R):5'- TGGATCTCTTCATCGCGAGG -3'

Sequencing Primer
(F):5'- ATTATCACAGTGTGGGCTACAG -3'
(R):5'- TTCATCGCGAGGCCCGAG -3'
Posted On2015-12-29