Incidental Mutation 'R4787:Cdkn2a'
ID367161
Institutional Source Beutler Lab
Gene Symbol Cdkn2a
Ensembl Gene ENSMUSG00000044303
Gene Namecyclin dependent kinase inhibitor 2A
Synonymsp16, Ink4a/Arf, p19, MTS1, p19ARF, Pctr1, p16INK4a, ARF-INK4a, Arf, INK4a-ARF
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location89274471-89294653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89276718 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 153 (R153H)
Ref Sequence ENSEMBL: ENSMUSP00000102748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060501] [ENSMUST00000107131]
PDB Structure
SOLUTION STRUCTURE OF THE N-TERMINAL 37 AMINO ACIDS OF THE MOUSE ARF TUMOR SUPPRESSOR PROTEIN [SOLUTION NMR]
Predicted Effect unknown
Transcript: ENSMUST00000060501
AA Change: A132T
SMART Domains Protein: ENSMUSP00000061847
Gene: ENSMUSG00000044303
AA Change: A132T

DomainStartEndE-ValueType
ANK 3 32 1.53e3 SMART
ANK 36 64 4.07e-1 SMART
ANK 69 98 4.44e2 SMART
ANK 102 131 1.01e2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107131
AA Change: R153H
SMART Domains Protein: ENSMUSP00000102748
Gene: ENSMUSG00000044303
AA Change: R153H

DomainStartEndE-ValueType
Blast:ANK 1 21 2e-6 BLAST
ANK 26 55 2.8e0 SMART
ANK 59 88 6.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129527
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]
PHENOTYPE: Null mutants of p16INK4a or p19ARF proteins each show increased tumor susceptibility and sensitivity to carcinogens. Loss of both gives very early onset. p19ARF nulls also show thymic hyperplasia and the eye's hyaloid vascular system fails to regress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Cdkn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Cdkn2a APN 4 89294332 critical splice donor site probably null 0.00
R0158:Cdkn2a UTSW 4 89276767 missense possibly damaging 0.92
R2073:Cdkn2a UTSW 4 89294493 missense possibly damaging 0.71
R5679:Cdkn2a UTSW 4 89276861 missense possibly damaging 0.88
R6863:Cdkn2a UTSW 4 89274766 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAAAATGGGAACTTATGGGTGTC -3'
(R):5'- AGCTCTTCTGCTCAACTACGG -3'

Sequencing Primer
(F):5'- CCATGTTCTCAGGCTCATTTGGG -3'
(R):5'- TCAACTACGGTGCAGATTCG -3'
Posted On2015-12-29