Incidental Mutation 'R4787:Rbm33'
ID367165
Institutional Source Beutler Lab
Gene Symbol Rbm33
Ensembl Gene ENSMUSG00000048271
Gene NameRNA binding motif protein 33
Synonyms6430512A10Rik, 3200001K10Rik, Prr8
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location28317121-28419239 bp(+) (GRCm38)
Type of Mutationintron (3129 bp from exon)
DNA Base Change (assembly) C to T at 28342437 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030920] [ENSMUST00000059644] [ENSMUST00000090355] [ENSMUST00000114884]
Predicted Effect probably null
Transcript: ENSMUST00000030920
AA Change: Q202*
SMART Domains Protein: ENSMUSP00000030920
Gene: ENSMUSG00000048271
AA Change: Q202*

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000059644
AA Change: Q202*
SMART Domains Protein: ENSMUSP00000062449
Gene: ENSMUSG00000048271
AA Change: Q202*

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
low complexity region 362 407 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
low complexity region 625 707 N/A INTRINSIC
low complexity region 817 837 N/A INTRINSIC
coiled coil region 846 891 N/A INTRINSIC
RRM 1160 1227 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090355
SMART Domains Protein: ENSMUSP00000091512
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114884
SMART Domains Protein: ENSMUSP00000110534
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 267 287 N/A INTRINSIC
low complexity region 322 367 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
low complexity region 585 667 N/A INTRINSIC
low complexity region 777 797 N/A INTRINSIC
coiled coil region 806 851 N/A INTRINSIC
RRM 1120 1187 4.7e-6 SMART
Meta Mutation Damage Score 0.9220 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Rbm33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Rbm33 APN 5 28410709 missense probably damaging 0.98
IGL01470:Rbm33 APN 5 28387848 missense probably damaging 1.00
IGL01565:Rbm33 APN 5 28391079 unclassified probably benign
IGL02119:Rbm33 APN 5 28339017 missense probably damaging 1.00
IGL02740:Rbm33 APN 5 28331123 missense probably damaging 1.00
IGL02869:Rbm33 APN 5 28410755 missense probably damaging 0.99
IGL03355:Rbm33 APN 5 28391061 unclassified probably benign
IGL03381:Rbm33 APN 5 28394392 missense unknown
FR4449:Rbm33 UTSW 5 28394168 small deletion probably benign
FR4548:Rbm33 UTSW 5 28394201 small deletion probably benign
R0091:Rbm33 UTSW 5 28352606 missense possibly damaging 0.94
R0725:Rbm33 UTSW 5 28394483 missense unknown
R1522:Rbm33 UTSW 5 28337004 missense probably damaging 1.00
R1918:Rbm33 UTSW 5 28387917 missense probably damaging 1.00
R2186:Rbm33 UTSW 5 28394230 missense unknown
R2448:Rbm33 UTSW 5 28342417 missense probably benign 0.01
R4151:Rbm33 UTSW 5 28387940 missense probably damaging 1.00
R4685:Rbm33 UTSW 5 28408282 unclassified probably benign
R4954:Rbm33 UTSW 5 28339276 missense probably damaging 1.00
R5013:Rbm33 UTSW 5 28342411 missense probably benign 0.05
R5141:Rbm33 UTSW 5 28352689 missense probably damaging 1.00
R5248:Rbm33 UTSW 5 28337052 critical splice donor site probably null
R5259:Rbm33 UTSW 5 28352774 intron probably null
R5695:Rbm33 UTSW 5 28339012 missense probably damaging 1.00
R5790:Rbm33 UTSW 5 28339298 missense probably damaging 1.00
R6591:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6668:Rbm33 UTSW 5 28342500 missense probably benign 0.01
R6691:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6930:Rbm33 UTSW 5 28352506 missense probably benign 0.09
R6931:Rbm33 UTSW 5 28410745 missense probably damaging 1.00
R7034:Rbm33 UTSW 5 28394498 missense unknown
R7056:Rbm33 UTSW 5 28394003 unclassified probably benign
R7224:Rbm33 UTSW 5 28394324 missense
R7579:Rbm33 UTSW 5 28368266 missense probably damaging 1.00
R7922:Rbm33 UTSW 5 28368399 intron probably null
R8009:Rbm33 UTSW 5 28394608 missense not run
R8051:Rbm33 UTSW 5 28352625 missense not run
RF011:Rbm33 UTSW 5 28394181 small deletion probably benign
RF026:Rbm33 UTSW 5 28394181 small deletion probably benign
RF047:Rbm33 UTSW 5 28394162 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGCTCTGTCAGGGCATC -3'
(R):5'- AACTCACTTCTCTAGGCCCAGG -3'

Sequencing Primer
(F):5'- GGCATCCCCACAGTAGAATG -3'
(R):5'- CAGGCTTGGGCTTCTACTACAAG -3'
Posted On2015-12-29