Incidental Mutation 'R4787:Rfc5'
ID367168
Institutional Source Beutler Lab
Gene Symbol Rfc5
Ensembl Gene ENSMUSG00000029363
Gene Namereplication factor C (activator 1) 5
Synonyms36.5kDa, 2610209F07Rik, 2610020K06Rik, 36kDa, Recc5
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location117378103-117389047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117382420 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000083652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031309] [ENSMUST00000086461] [ENSMUST00000111953] [ENSMUST00000111959]
Predicted Effect probably benign
Transcript: ENSMUST00000031309
SMART Domains Protein: ENSMUSP00000031309
Gene: ENSMUSG00000029364

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:WD40 17 54 5e-17 BLAST
WD40 81 139 3.57e0 SMART
WD40 142 182 1.43e-9 SMART
WD40 186 225 1.59e-7 SMART
WD40 228 267 7.16e-10 SMART
WD40 270 321 6.53e-4 SMART
WD40 324 361 6.42e-1 SMART
SOCS 360 403 5.56e-17 SMART
SOCS_box 366 402 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086461
AA Change: T236A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083652
Gene: ENSMUSG00000029363
AA Change: T236A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
AAA 51 179 4.16e-14 SMART
Pfam:Rep_fac_C 241 327 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111953
SMART Domains Protein: ENSMUSP00000107584
Gene: ENSMUSG00000029363

DomainStartEndE-ValueType
Pfam:DUF815 3 105 4.8e-8 PFAM
Pfam:RuvB_N 10 100 3e-8 PFAM
Pfam:Rad17 14 110 9.5e-13 PFAM
Pfam:AAA_19 43 94 1.4e-8 PFAM
Pfam:AAA 55 103 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111959
SMART Domains Protein: ENSMUSP00000107590
Gene: ENSMUSG00000029364

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Blast:WD40 18 56 7e-18 BLAST
WD40 83 141 3.57e0 SMART
WD40 144 184 1.43e-9 SMART
WD40 188 227 1.59e-7 SMART
WD40 230 269 7.16e-10 SMART
WD40 272 323 6.53e-4 SMART
WD40 326 363 6.42e-1 SMART
SOCS 362 405 5.56e-17 SMART
SOCS_box 368 404 1.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150962
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of the replication factor C complex, which consists of five distinct subunits (140, 40, 38, 37, and 36 kDa) and is required for DNA replication. This subunit interacts with the C-terminal region of proliferating cell nuclear antigen and is required to open and load proliferating cell nuclear antigen onto DNA during S phase. It is a member of the AAA+ (ATPases associated with various cellular activities) ATPase family and forms a core complex with the 38 and 40 kDa subunits that possesses DNA-dependent ATPase activity. A related pseudogene has been identified on chromosome 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Rfc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Rfc5 APN 5 117386866 splice site probably benign
R2078:Rfc5 UTSW 5 117380803 missense probably benign 0.01
R2431:Rfc5 UTSW 5 117385458 missense probably damaging 1.00
R4890:Rfc5 UTSW 5 117386820 missense probably damaging 1.00
R6385:Rfc5 UTSW 5 117385398 missense probably benign 0.03
R6386:Rfc5 UTSW 5 117385398 missense probably benign 0.03
R6963:Rfc5 UTSW 5 117387866 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCGCTTAGACTGTGAACGG -3'
(R):5'- GTAGTGTTCACAGCAGAGGG -3'

Sequencing Primer
(F):5'- AAGCTCCGGACAGCCATTGAG -3'
(R):5'- GCAGCCCTTCCAGTGCAC -3'
Posted On2015-12-29