Incidental Mutation 'R4787:Taok2'
ID367181
Institutional Source Beutler Lab
Gene Symbol Taok2
Ensembl Gene ENSMUSG00000059981
Gene NameTAO kinase 2
SynonymsMAP3K17, TAO2, 1110033K02Rik, PSK1, TAO1
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126865678-126884703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126868132 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 167 (S167L)
Ref Sequence ENSEMBL: ENSMUSP00000150069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037248] [ENSMUST00000071268] [ENSMUST00000117394] [ENSMUST00000132808] [ENSMUST00000214525]
Predicted Effect probably benign
Transcript: ENSMUST00000037248
SMART Domains Protein: ENSMUSP00000035535
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 96 113 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 229 244 N/A INTRINSIC
low complexity region 286 339 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 405 419 N/A INTRINSIC
internal_repeat_1 420 443 6.44e-5 PROSPERO
internal_repeat_1 440 463 6.44e-5 PROSPERO
CHZ 529 565 1.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071268
AA Change: S815L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981
AA Change: S815L

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117394
SMART Domains Protein: ENSMUSP00000112963
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
transmembrane domain 962 984 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1017 1039 N/A INTRINSIC
transmembrane domain 1052 1074 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1197 1215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130371
Predicted Effect probably benign
Transcript: ENSMUST00000132808
SMART Domains Protein: ENSMUSP00000115145
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
low complexity region 88 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205512
Predicted Effect possibly damaging
Transcript: ENSMUST00000214525
AA Change: S167L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. Mice homozygous for a targeted allele exhibit resistance to the ataxic effect of alcohol, reduced blood ethanol content, increased alcohol consumption, impaired CPP for alcohol, and impaired habituation in an open field. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Taok2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Taok2 APN 7 126872411 missense probably damaging 0.98
IGL01153:Taok2 APN 7 126871032 missense probably damaging 0.99
IGL02689:Taok2 APN 7 126876098 missense probably damaging 0.99
R0049:Taok2 UTSW 7 126866411 missense possibly damaging 0.92
R0601:Taok2 UTSW 7 126879433 missense probably damaging 1.00
R0976:Taok2 UTSW 7 126875151 missense possibly damaging 0.77
R1456:Taok2 UTSW 7 126880141 missense probably benign 0.09
R1643:Taok2 UTSW 7 126875938 unclassified probably benign
R2084:Taok2 UTSW 7 126870191 missense probably benign 0.04
R2212:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R2471:Taok2 UTSW 7 126875100 missense probably damaging 0.98
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3412:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R4085:Taok2 UTSW 7 126874725 missense possibly damaging 0.90
R4440:Taok2 UTSW 7 126866521 missense possibly damaging 0.85
R4775:Taok2 UTSW 7 126870768 missense probably damaging 0.99
R4788:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4791:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4927:Taok2 UTSW 7 126876041 missense probably damaging 1.00
R5651:Taok2 UTSW 7 126880283 missense probably damaging 1.00
R6371:Taok2 UTSW 7 126870147 missense probably damaging 1.00
R6408:Taok2 UTSW 7 126870992 missense probably benign
R6605:Taok2 UTSW 7 126878758 missense probably damaging 1.00
R6828:Taok2 UTSW 7 126871875 intron probably null
R6863:Taok2 UTSW 7 126871937 missense probably damaging 0.99
R6962:Taok2 UTSW 7 126866916 critical splice acceptor site probably null
R6967:Taok2 UTSW 7 126870392 missense probably damaging 0.98
R7127:Taok2 UTSW 7 126867154 missense possibly damaging 0.82
R7187:Taok2 UTSW 7 126872380 missense probably damaging 0.99
R7307:Taok2 UTSW 7 126866818 missense probably damaging 1.00
R7325:Taok2 UTSW 7 126871088 missense probably benign
R7429:Taok2 UTSW 7 126870677 missense possibly damaging 0.95
R7497:Taok2 UTSW 7 126874878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGCAGGGTGACTTTACTTTC -3'
(R):5'- AAGCAGTTCCAGGAGACGTG -3'

Sequencing Primer
(F):5'- AGGCAGGGTGACTTTACTTTCTTAAG -3'
(R):5'- TTCCAGGAGACGTGTAAGATCC -3'
Posted On2015-12-29