Mutagenetix > Incidental Mutations

Incidental Mutation 'R4787:Igsf9b'

367185

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

041975-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.857) question?

Stock #

R4787 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27317456 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 171 (V171I)

Ref Sequence

ENSEMBL: ENSMUSP00000149356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

Predicted Effect

probably benign
Transcript: ENSMUST00000115247
AA Change: V171I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: V171I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133213
AA Change: V171I

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: V171I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000214357
AA Change: V171I

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.1509

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

100% (72/72)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	C	A	8: 72,445,164	Y138*	probably null	Het
4933440M02Rik	T	C	7: 125,331,542		noncoding transcript	Het
Amy2b	T	C	3: 113,151,318		noncoding transcript	Het
Anxa1	T	A	19: 20,373,754	D334V	probably damaging	Het
Atoh8	T	C	6: 72,223,777	T310A	possibly damaging	Het
BC002059	G	A	17: 16,973,548		noncoding transcript	Het
C87499	T	A	4: 88,629,213	K74*	probably null	Het
Ccdc40	A	G	11: 119,253,621	D924G	possibly damaging	Het
Ccm2l	A	T	2: 153,079,502	M433L	probably benign	Het
Cd209e	T	C	8: 3,851,181	S158G	probably null	Het
Cdkn2a	C	T	4: 89,276,718	R153H	unknown	Het
Cfap69	A	G	5: 5,646,934		probably null	Het
Col6a5	T	C	9: 105,931,081	T923A	unknown	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Ddrgk1	A	G	2: 130,658,328	F216S	probably damaging	Het
Dysf	T	A	6: 84,203,328	C1995*	probably null	Het
Epb41l5	G	A	1: 119,595,995	P467S	probably benign	Het
Extl1	G	A	4: 134,364,667	L292F	probably damaging	Het
Fsd1	A	G	17: 55,996,257	N409D	possibly damaging	Het
Gm15455	A	T	1: 33,837,722		noncoding transcript	Het
Gm5514	C	A	19: 21,938,237		noncoding transcript	Het
Gm8894	A	G	14: 55,420,715		noncoding transcript	Het
Gm8979	T	C	7: 106,081,834		noncoding transcript	Het
Gtf3c2	C	T	5: 31,157,577	S942N	probably benign	Het
H2-Ab1	A	T	17: 34,267,467	T167S	possibly damaging	Het
Ighv8-9	C	T	12: 115,468,514	R59H	probably damaging	Het
Il31ra	C	T	13: 112,527,545	E533K	possibly damaging	Het
Iqgap1	A	C	7: 80,735,513	L1022R	probably damaging	Het
Kcna4	T	C	2: 107,296,468	F516L	probably damaging	Het
Kmt2e	A	G	5: 23,463,083	T47A	possibly damaging	Het
L3mbtl2	A	G	15: 81,663,974		probably benign	Het
Lipo1	T	A	19: 33,780,349	Q240L	probably benign	Het
Lpar5	A	G	6: 125,082,498		probably null	Het
Lrrk2	A	G	15: 91,712,828	D541G	probably benign	Het
Med9	T	A	11: 59,948,440	N58K	probably benign	Het
Meig1	A	G	2: 3,409,214	V83A	possibly damaging	Het
Natd1	A	C	11: 60,906,996	C34W	probably damaging	Het
Nup205	T	A	6: 35,202,061	C689S	probably damaging	Het
Olfr1161	T	C	2: 88,024,860	M46T	possibly damaging	Het
Olfr1199	T	A	2: 88,755,875	K267*	probably null	Het
Olfr2	G	A	7: 107,001,086	A258V	probably benign	Het
Olfr654	T	C	7: 104,587,960	M52T	probably benign	Het
Pdgfrb	A	C	18: 61,079,687	S888R	probably damaging	Het
Plppr4	T	C	3: 117,322,330	E626G	probably damaging	Het
Ppfia3	C	A	7: 45,340,626	A1159S	possibly damaging	Het
Prex1	A	G	2: 166,638,340	V160A	probably benign	Het
Psmb7	C	T	2: 38,588,271	C247Y	probably benign	Het
Rbm33	C	T	5: 28,342,437		probably null	Het
Rfc5	T	C	5: 117,382,420	T236A	probably benign	Het
Sdk1	G	T	5: 141,582,413	R122L	probably benign	Het
Sh3bp1	T	C	15: 78,907,995	S451P	possibly damaging	Het
Smap1	G	T	1: 23,849,266		probably benign	Het
Smc2	T	A	4: 52,462,927	V639E	probably damaging	Het
Synpo2l	T	A	14: 20,661,697	Q511L	possibly damaging	Het
Taok2	G	A	7: 126,868,132	S167L	possibly damaging	Het
Tbc1d17	G	A	7: 44,843,064	P392S	probably benign	Het
Tef	T	A	15: 81,823,557	I261N	probably damaging	Het
Tmbim1	T	C	1: 74,295,360	N14D	possibly damaging	Het
Tmprss11c	T	C	5: 86,256,453	K121R	probably benign	Het
Trim36	C	A	18: 46,172,532	M461I	probably benign	Het
Trpc1	T	A	9: 95,721,415	M355L	probably benign	Het
Tspyl4	A	C	10: 34,297,764	D84A	probably benign	Het
Twf1	G	T	15: 94,584,434	P144T	probably damaging	Het
Ugt1a7c	T	C	1: 88,095,670	C184R	probably damaging	Het
Unc79	C	T	12: 103,046,998	P283S	probably damaging	Het
Usp45	T	C	4: 21,796,860	C49R	probably benign	Het
Wdr11	T	A	7: 129,608,934		probably benign	Het
Wdr27	A	T	17: 14,932,554	M97K	possibly damaging	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	intron	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGGGTAGGAGTTTCTGCACTC -3'
(R):5'- AAGTCAGGCCATGAGGTTGC -3'

Sequencing Primer
(F):5'- AGGAGTTTCTGCACTCTTTGTTC -3'
(R):5'- AGGTTGCCTGCCTCCAC -3'

Posted On

2015-12-29