Incidental Mutation 'R0412:Atp7b'
ID 36719
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene Name ATPase, Cu++ transporting, beta polypeptide
Synonyms Atp7a, WND, Wilson protein
MMRRC Submission 038614-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.602) question?
Stock # R0412 (G1)
Quality Score 91
Status Validated
Chromosome 8
Chromosomal Location 22482801-22550321 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 22485675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000006742] [ENSMUST00000110738] [ENSMUST00000110738]
AlphaFold Q64446
Predicted Effect probably null
Transcript: ENSMUST00000006742
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006742
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110738
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110738
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 C A 7: 101,039,429 (GRCm39) A563D probably damaging Het
Arhgap28 G A 17: 68,203,253 (GRCm39) L67F probably damaging Het
Auts2 A G 5: 131,475,669 (GRCm39) F485L probably benign Het
Ccdc68 A G 18: 70,093,510 (GRCm39) E239G probably damaging Het
Cdc42bpg T G 19: 6,363,487 (GRCm39) L449R probably damaging Het
Colgalt2 G T 1: 152,384,312 (GRCm39) A551S possibly damaging Het
Ddx41 G T 13: 55,678,421 (GRCm39) S630Y probably damaging Het
Dntt T C 19: 41,031,372 (GRCm39) L274P probably damaging Het
Fhl4 G T 10: 84,934,680 (GRCm39) H34N possibly damaging Het
Filip1 A T 9: 79,727,571 (GRCm39) N349K possibly damaging Het
Gm9894 C T 13: 67,913,145 (GRCm39) noncoding transcript Het
Gpr179 A G 11: 97,229,633 (GRCm39) S841P probably damaging Het
Gpr35 G T 1: 92,910,506 (GRCm39) V73L probably benign Het
Grik5 A G 7: 24,713,099 (GRCm39) V809A possibly damaging Het
H2-T13 T A 17: 36,392,413 (GRCm39) probably benign Het
Heatr5b T C 17: 79,128,283 (GRCm39) T451A probably benign Het
Hmcn2 G A 2: 31,278,259 (GRCm39) V1654M probably damaging Het
Htra3 G T 5: 35,828,409 (GRCm39) A157E probably damaging Het
Igf2r A T 17: 12,902,835 (GRCm39) V2405D probably damaging Het
Irs3 C A 5: 137,642,139 (GRCm39) R433L probably benign Het
Kcmf1 G A 6: 72,825,224 (GRCm39) Q239* probably null Het
Kcnk9 A G 15: 72,384,905 (GRCm39) probably benign Het
Kif28 A G 1: 179,530,091 (GRCm39) V622A probably benign Het
Klrb1f A T 6: 129,031,294 (GRCm39) I164F probably benign Het
Lama2 A G 10: 27,066,621 (GRCm39) S1087P possibly damaging Het
Mchr1 A T 15: 81,119,948 (GRCm39) probably benign Het
Mcidas A G 13: 113,135,677 (GRCm39) T367A probably damaging Het
Mphosph8 A C 14: 56,911,870 (GRCm39) K298Q probably damaging Het
Mroh2a G T 1: 88,162,938 (GRCm39) Q360H probably benign Het
Mst1 A C 9: 107,960,793 (GRCm39) D461A probably benign Het
Nckap1l A T 15: 103,373,079 (GRCm39) S311C probably benign Het
Or2y1 T A 11: 49,385,594 (GRCm39) V78E probably damaging Het
Or4c125 T A 2: 89,170,422 (GRCm39) M75L probably benign Het
Or5m9b C T 2: 85,905,435 (GRCm39) A117V probably benign Het
Or8c11 A C 9: 38,290,090 (GRCm39) K298N probably damaging Het
Pde3a T G 6: 141,444,410 (GRCm39) C1073G probably damaging Het
Pkhd1 T C 1: 20,188,012 (GRCm39) D3432G probably damaging Het
Ppargc1b G T 18: 61,448,932 (GRCm39) P130Q probably damaging Het
Ppp6r1 A G 7: 4,645,213 (GRCm39) I228T probably damaging Het
Pram1 A G 17: 33,860,480 (GRCm39) N349S probably benign Het
Ranbp6 C T 19: 29,789,483 (GRCm39) V290I possibly damaging Het
Rcan3 A T 4: 135,143,914 (GRCm39) probably null Het
Scn8a G C 15: 100,906,187 (GRCm39) probably benign Het
Slc12a5 C T 2: 164,835,982 (GRCm39) T900M probably benign Het
Srsf10 A G 4: 135,585,714 (GRCm39) Y55C probably damaging Het
Syt7 G T 19: 10,421,444 (GRCm39) E450* probably null Het
Tbrg4 T C 11: 6,573,832 (GRCm39) K130R probably benign Het
Tgm7 C A 2: 120,931,546 (GRCm39) V206F probably damaging Het
Tmem131l T C 3: 83,938,955 (GRCm39) D67G probably damaging Het
Ttc7 A G 17: 87,637,472 (GRCm39) K409R probably benign Het
Unc80 A T 1: 66,590,096 (GRCm39) probably benign Het
Vmn1r171 C T 7: 23,332,080 (GRCm39) L102F possibly damaging Het
Vmn2r59 A C 7: 41,695,916 (GRCm39) probably benign Het
Vsig2 A G 9: 37,453,986 (GRCm39) R191G probably damaging Het
Wdr86 T A 5: 24,923,232 (GRCm39) Q153H probably benign Het
Wdr87-ps C G 7: 29,229,995 (GRCm39) noncoding transcript Het
Xxylt1 T A 16: 30,826,616 (GRCm39) N233I probably damaging Het
Zfp160 A T 17: 21,247,139 (GRCm39) E563V probably damaging Het
Zfp345 T A 2: 150,315,323 (GRCm39) E71D probably benign Het
Zfp541 A G 7: 15,816,099 (GRCm39) D862G possibly damaging Het
Zfp639 A C 3: 32,571,259 (GRCm39) Q47P possibly damaging Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22,501,114 (GRCm39) missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22,517,543 (GRCm39) splice site probably null
IGL01600:Atp7b APN 8 22,517,541 (GRCm39) splice site probably null
IGL01713:Atp7b APN 8 22,518,589 (GRCm39) missense probably damaging 1.00
IGL01778:Atp7b APN 8 22,484,844 (GRCm39) missense probably benign 0.42
IGL01926:Atp7b APN 8 22,501,797 (GRCm39) missense probably damaging 0.98
IGL02312:Atp7b APN 8 22,484,786 (GRCm39) missense probably damaging 0.99
IGL02562:Atp7b APN 8 22,518,101 (GRCm39) missense probably benign
IGL02573:Atp7b APN 8 22,512,486 (GRCm39) missense probably benign 0.00
IGL02603:Atp7b APN 8 22,484,792 (GRCm39) missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22,518,454 (GRCm39) missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22,512,493 (GRCm39) missense probably benign 0.00
IGL03145:Atp7b APN 8 22,508,159 (GRCm39) missense probably damaging 1.00
daffodil UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
menace UTSW 8 22,512,381 (GRCm39) missense probably damaging 0.97
PIT4131001:Atp7b UTSW 8 22,484,672 (GRCm39) missense probably damaging 1.00
R0023:Atp7b UTSW 8 22,501,089 (GRCm39) missense probably damaging 1.00
R0046:Atp7b UTSW 8 22,550,011 (GRCm39) missense probably benign 0.00
R0128:Atp7b UTSW 8 22,518,188 (GRCm39) missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22,518,188 (GRCm39) missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22,518,467 (GRCm39) missense probably benign 0.22
R0856:Atp7b UTSW 8 22,487,647 (GRCm39) missense probably damaging 1.00
R0906:Atp7b UTSW 8 22,517,842 (GRCm39) missense probably benign
R0989:Atp7b UTSW 8 22,518,710 (GRCm39) missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22,501,801 (GRCm39) missense probably benign 0.17
R1517:Atp7b UTSW 8 22,487,374 (GRCm39) missense probably damaging 1.00
R1521:Atp7b UTSW 8 22,517,689 (GRCm39) missense probably damaging 0.96
R1529:Atp7b UTSW 8 22,518,740 (GRCm39) missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22,501,039 (GRCm39) missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22,496,403 (GRCm39) missense probably damaging 1.00
R1815:Atp7b UTSW 8 22,501,667 (GRCm39) missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22,517,996 (GRCm39) missense probably damaging 1.00
R2133:Atp7b UTSW 8 22,501,093 (GRCm39) missense probably damaging 1.00
R2155:Atp7b UTSW 8 22,503,600 (GRCm39) missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22,504,563 (GRCm39) missense probably damaging 0.99
R2256:Atp7b UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
R2257:Atp7b UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
R2274:Atp7b UTSW 8 22,510,848 (GRCm39) missense probably benign 0.20
R2475:Atp7b UTSW 8 22,484,792 (GRCm39) missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R2907:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R3421:Atp7b UTSW 8 22,518,686 (GRCm39) missense probably damaging 1.00
R3422:Atp7b UTSW 8 22,518,686 (GRCm39) missense probably damaging 1.00
R3688:Atp7b UTSW 8 22,494,246 (GRCm39) missense probably damaging 1.00
R3945:Atp7b UTSW 8 22,510,880 (GRCm39) missense probably benign 0.02
R4235:Atp7b UTSW 8 22,501,039 (GRCm39) missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22,490,137 (GRCm39) missense probably benign 0.00
R4701:Atp7b UTSW 8 22,490,137 (GRCm39) missense probably benign 0.00
R4877:Atp7b UTSW 8 22,518,617 (GRCm39) missense probably damaging 0.98
R4962:Atp7b UTSW 8 22,510,901 (GRCm39) missense probably damaging 1.00
R5009:Atp7b UTSW 8 22,517,714 (GRCm39) missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22,505,885 (GRCm39) splice site probably null
R5038:Atp7b UTSW 8 22,518,472 (GRCm39) missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22,504,570 (GRCm39) missense probably benign
R5467:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R5468:Atp7b UTSW 8 22,549,986 (GRCm39) critical splice donor site probably null
R5512:Atp7b UTSW 8 22,502,755 (GRCm39) missense probably benign 0.20
R5563:Atp7b UTSW 8 22,518,730 (GRCm39) missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22,508,144 (GRCm39) missense probably damaging 1.00
R5773:Atp7b UTSW 8 22,517,879 (GRCm39) missense probably benign
R5941:Atp7b UTSW 8 22,487,512 (GRCm39) missense probably damaging 0.98
R6227:Atp7b UTSW 8 22,510,841 (GRCm39) missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22,505,943 (GRCm39) nonsense probably null
R6290:Atp7b UTSW 8 22,510,836 (GRCm39) missense probably damaging 1.00
R6368:Atp7b UTSW 8 22,510,771 (GRCm39) splice site probably null
R6647:Atp7b UTSW 8 22,518,494 (GRCm39) missense probably damaging 1.00
R6788:Atp7b UTSW 8 22,494,391 (GRCm39) missense probably benign 0.37
R6830:Atp7b UTSW 8 22,512,381 (GRCm39) missense probably damaging 0.97
R6886:Atp7b UTSW 8 22,518,706 (GRCm39) missense probably benign 0.01
R6928:Atp7b UTSW 8 22,484,828 (GRCm39) missense probably benign
R6965:Atp7b UTSW 8 22,518,101 (GRCm39) missense probably benign
R7203:Atp7b UTSW 8 22,487,351 (GRCm39) missense probably damaging 1.00
R7222:Atp7b UTSW 8 22,512,394 (GRCm39) nonsense probably null
R7344:Atp7b UTSW 8 22,487,515 (GRCm39) missense probably damaging 1.00
R7384:Atp7b UTSW 8 22,512,331 (GRCm39) missense probably benign 0.01
R7449:Atp7b UTSW 8 22,501,865 (GRCm39) missense probably damaging 0.98
R7451:Atp7b UTSW 8 22,504,700 (GRCm39) nonsense probably null
R7607:Atp7b UTSW 8 22,501,522 (GRCm39) missense probably damaging 1.00
R8140:Atp7b UTSW 8 22,518,576 (GRCm39) missense probably damaging 1.00
R8160:Atp7b UTSW 8 22,487,575 (GRCm39) missense probably damaging 0.98
R8349:Atp7b UTSW 8 22,503,556 (GRCm39) missense probably damaging 1.00
R8421:Atp7b UTSW 8 22,518,487 (GRCm39) missense probably benign 0.01
R8449:Atp7b UTSW 8 22,503,556 (GRCm39) missense probably damaging 1.00
R8749:Atp7b UTSW 8 22,518,334 (GRCm39) missense probably damaging 0.96
R8989:Atp7b UTSW 8 22,510,911 (GRCm39) missense probably benign 0.06
R9210:Atp7b UTSW 8 22,487,406 (GRCm39) missense probably damaging 1.00
R9353:Atp7b UTSW 8 22,517,890 (GRCm39) missense possibly damaging 0.78
R9462:Atp7b UTSW 8 22,490,160 (GRCm39) missense probably damaging 0.99
R9485:Atp7b UTSW 8 22,502,778 (GRCm39) missense probably damaging 0.99
Z1176:Atp7b UTSW 8 22,518,730 (GRCm39) missense probably benign 0.07
Z1177:Atp7b UTSW 8 22,484,893 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTACCACTGCTAAGTGGGCAGTC -3'
(R):5'- GTGTCTTTTCTGACCTCAGAGCAGC -3'

Sequencing Primer
(F):5'- CAGGAAACATGCTGCTGTGC -3'
(R):5'- TAGAGACCAGGTTGCTACCTC -3'
Posted On 2013-05-09