Incidental Mutation 'R4787:Tef'
ID367199
Institutional Source Beutler Lab
Gene Symbol Tef
Ensembl Gene ENSMUSG00000022389
Gene Namethyrotroph embryonic factor
Synonyms2310028D20Rik
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81802421-81826863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81823557 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 261 (I261N)
Ref Sequence ENSEMBL: ENSMUSP00000023024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023024] [ENSMUST00000109553] [ENSMUST00000168200]
Predicted Effect probably damaging
Transcript: ENSMUST00000023024
AA Change: I261N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023024
Gene: ENSMUSG00000022389
AA Change: I261N

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 131 145 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
BRLZ 229 293 1.87e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109553
AA Change: I245N

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105180
Gene: ENSMUSG00000022389
AA Change: I245N

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 134 143 N/A INTRINSIC
BRLZ 213 277 1.87e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167138
Predicted Effect probably benign
Transcript: ENSMUST00000168200
SMART Domains Protein: ENSMUSP00000132026
Gene: ENSMUSG00000022389

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 81 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168632
Meta Mutation Damage Score 0.5510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PAR (proline and acidic amino acid-rich) subfamily of basic region/leucine zipper (bZIP) transcription factors. It is expressed in a broad range of cells and tissues in adult animals, however, during embryonic development, TEF expression appears to be restricted to the developing anterior pituitary gland, coincident with the appearance of thyroid-stimulating hormone, beta (TSHB). Indeed, TEF can bind to, and transactivate the TSHB promoter. It shows homology (in the functional domains) with other members of the PAR-bZIP subfamily of transcription factors, which include albumin D box-binding protein (DBP), human hepatic leukemia factor (HLF) and chicken vitellogenin gene-binding protein (VBP); VBP is considered the chicken homologue of TEF. Different members of the subfamily can readily form heterodimers, and share DNA-binding, and transcriptional regulatory properties. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutant are subject to seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in Tef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Tef APN 15 81815183 missense probably benign 0.00
IGL02303:Tef APN 15 81821295 missense probably benign 0.01
IGL02399:Tef APN 15 81815100 missense probably damaging 1.00
R4015:Tef UTSW 15 81823605 missense probably damaging 0.99
R4786:Tef UTSW 15 81815252 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACAACGTTGAACTATGTGCAG -3'
(R):5'- TCCTAAGTCTCCACACGAGTG -3'

Sequencing Primer
(F):5'- CGTTGAACTATGTGCAGAGGAG -3'
(R):5'- ACACGAGTGGGGTCCAG -3'
Posted On2015-12-29