Incidental Mutation 'R4787:Wdr27'
ID367202
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene NameWD repeat domain 27
Synonyms0610012K18Rik
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14818519-14943158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14932554 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 97 (M97K)
Ref Sequence ENSEMBL: ENSMUSP00000155992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
Predicted Effect probably benign
Transcript: ENSMUST00000170386
AA Change: M97K

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: M97K

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228330
AA Change: M97K

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232147
AA Change: M97K

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.5995 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
H2-Ab1 A T 17: 34,267,467 T167S possibly damaging Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 14934569 missense probably benign 0.01
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4853:Wdr27 UTSW 17 14917213 splice site probably null
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5784:Wdr27 UTSW 17 14926233 missense probably damaging 1.00
R5809:Wdr27 UTSW 17 14883669 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6584:Wdr27 UTSW 17 14901769 missense probably damaging 1.00
R6705:Wdr27 UTSW 17 14934590 missense probably damaging 1.00
R7511:Wdr27 UTSW 17 14883703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCAGTCTTCTCCATGGTAG -3'
(R):5'- TGATCAGCAGTGTCTTCAAGG -3'

Sequencing Primer
(F):5'- CTTGTAGGTCACCATCCAGGAAG -3'
(R):5'- CAGCAGTGTCTTCAAGGATTATAATG -3'
Posted On2015-12-29