Incidental Mutation 'R4787:H2-Ab1'
ID367204
Institutional Source Beutler Lab
Gene Symbol H2-Ab1
Ensembl Gene ENSMUSG00000073421
Gene Namehistocompatibility 2, class II antigen A, beta 1
SynonymsA beta, Abeta, Ia-2, IAb, Rmcs1, I-A, H-2Ab, I-Abeta, Ia2, H2-Ab
MMRRC Submission 041975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4787 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34263209-34269418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34267467 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 167 (T167S)
Ref Sequence ENSEMBL: ENSMUSP00000041008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040828]
PDB Structure
CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040828
AA Change: T167S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041008
Gene: ENSMUSG00000073421
AA Change: T167S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
MHC_II_beta 40 114 1.53e-47 SMART
IGc1 140 211 8.47e-34 SMART
transmembrane domain 228 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174875
Meta Mutation Damage Score 0.1083 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit depletion of mature CD4+ T cells, deficiency in cell-mediated immune responses, and increased susceptibility to viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,164 Y138* probably null Het
4933440M02Rik T C 7: 125,331,542 noncoding transcript Het
Amy2b T C 3: 113,151,318 noncoding transcript Het
Anxa1 T A 19: 20,373,754 D334V probably damaging Het
Atoh8 T C 6: 72,223,777 T310A possibly damaging Het
BC002059 G A 17: 16,973,548 noncoding transcript Het
C87499 T A 4: 88,629,213 K74* probably null Het
Ccdc40 A G 11: 119,253,621 D924G possibly damaging Het
Ccm2l A T 2: 153,079,502 M433L probably benign Het
Cd209e T C 8: 3,851,181 S158G probably null Het
Cdkn2a C T 4: 89,276,718 R153H unknown Het
Cfap69 A G 5: 5,646,934 probably null Het
Col6a5 T C 9: 105,931,081 T923A unknown Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddrgk1 A G 2: 130,658,328 F216S probably damaging Het
Dysf T A 6: 84,203,328 C1995* probably null Het
Epb41l5 G A 1: 119,595,995 P467S probably benign Het
Extl1 G A 4: 134,364,667 L292F probably damaging Het
Fsd1 A G 17: 55,996,257 N409D possibly damaging Het
Gm15455 A T 1: 33,837,722 noncoding transcript Het
Gm5514 C A 19: 21,938,237 noncoding transcript Het
Gm8894 A G 14: 55,420,715 noncoding transcript Het
Gm8979 T C 7: 106,081,834 noncoding transcript Het
Gtf3c2 C T 5: 31,157,577 S942N probably benign Het
Ighv8-9 C T 12: 115,468,514 R59H probably damaging Het
Igsf9b G A 9: 27,317,456 V171I probably benign Het
Il31ra C T 13: 112,527,545 E533K possibly damaging Het
Iqgap1 A C 7: 80,735,513 L1022R probably damaging Het
Kcna4 T C 2: 107,296,468 F516L probably damaging Het
Kmt2e A G 5: 23,463,083 T47A possibly damaging Het
L3mbtl2 A G 15: 81,663,974 probably benign Het
Lipo1 T A 19: 33,780,349 Q240L probably benign Het
Lpar5 A G 6: 125,082,498 probably null Het
Lrrk2 A G 15: 91,712,828 D541G probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Meig1 A G 2: 3,409,214 V83A possibly damaging Het
Natd1 A C 11: 60,906,996 C34W probably damaging Het
Nup205 T A 6: 35,202,061 C689S probably damaging Het
Olfr1161 T C 2: 88,024,860 M46T possibly damaging Het
Olfr1199 T A 2: 88,755,875 K267* probably null Het
Olfr2 G A 7: 107,001,086 A258V probably benign Het
Olfr654 T C 7: 104,587,960 M52T probably benign Het
Pdgfrb A C 18: 61,079,687 S888R probably damaging Het
Plppr4 T C 3: 117,322,330 E626G probably damaging Het
Ppfia3 C A 7: 45,340,626 A1159S possibly damaging Het
Prex1 A G 2: 166,638,340 V160A probably benign Het
Psmb7 C T 2: 38,588,271 C247Y probably benign Het
Rbm33 C T 5: 28,342,437 probably null Het
Rfc5 T C 5: 117,382,420 T236A probably benign Het
Sdk1 G T 5: 141,582,413 R122L probably benign Het
Sh3bp1 T C 15: 78,907,995 S451P possibly damaging Het
Smap1 G T 1: 23,849,266 probably benign Het
Smc2 T A 4: 52,462,927 V639E probably damaging Het
Synpo2l T A 14: 20,661,697 Q511L possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tbc1d17 G A 7: 44,843,064 P392S probably benign Het
Tef T A 15: 81,823,557 I261N probably damaging Het
Tmbim1 T C 1: 74,295,360 N14D possibly damaging Het
Tmprss11c T C 5: 86,256,453 K121R probably benign Het
Trim36 C A 18: 46,172,532 M461I probably benign Het
Trpc1 T A 9: 95,721,415 M355L probably benign Het
Tspyl4 A C 10: 34,297,764 D84A probably benign Het
Twf1 G T 15: 94,584,434 P144T probably damaging Het
Ugt1a7c T C 1: 88,095,670 C184R probably damaging Het
Unc79 C T 12: 103,046,998 P283S probably damaging Het
Usp45 T C 4: 21,796,860 C49R probably benign Het
Wdr11 T A 7: 129,608,934 probably benign Het
Wdr27 A T 17: 14,932,554 M97K possibly damaging Het
Other mutations in H2-Ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:H2-Ab1 APN 17 34267575 missense probably damaging 1.00
IGL01941:H2-Ab1 APN 17 34267434 nonsense probably null
IGL02826:H2-Ab1 APN 17 34264911 missense probably damaging 0.98
R0479:H2-Ab1 UTSW 17 34264968 missense possibly damaging 0.68
R0815:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R0863:H2-Ab1 UTSW 17 34267354 missense probably damaging 0.99
R1796:H2-Ab1 UTSW 17 34267372 missense probably damaging 0.99
R2875:H2-Ab1 UTSW 17 34263312 start codon destroyed probably benign 0.21
R4042:H2-Ab1 UTSW 17 34264860 missense probably benign
R4687:H2-Ab1 UTSW 17 34264809 missense probably damaging 0.99
R4761:H2-Ab1 UTSW 17 34267500 missense probably damaging 0.98
R5111:H2-Ab1 UTSW 17 34267482 missense probably damaging 0.96
R5155:H2-Ab1 UTSW 17 34267384 missense possibly damaging 0.89
R5194:H2-Ab1 UTSW 17 34269378 utr 3 prime probably benign
R6869:H2-Ab1 UTSW 17 34267563 missense probably damaging 1.00
R7037:H2-Ab1 UTSW 17 34267989 missense probably damaging 0.99
R7054:H2-Ab1 UTSW 17 34263342 missense probably benign 0.41
R7250:H2-Ab1 UTSW 17 34267507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATTCATTCCCACCCTG -3'
(R):5'- ACACCTAAAATCCCATGTCATGTG -3'

Sequencing Primer
(F):5'- GGGAGTCTCCACATTGCCTCAC -3'
(R):5'- CCATGTCATGTGGGGCC -3'
Posted On2015-12-29