Incidental Mutation 'R0412:Filip1'
ID36722
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Namefilamin A interacting protein 1
Synonyms5730485H21Rik
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R0412 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location79815051-80012851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79820289 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 349 (N349K)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093811
AA Change: N349K

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: N349K

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7866:Filip1 UTSW 9 79818943 missense probably benign 0.03
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
R8798:Filip1 UTSW 9 79820090 missense possibly damaging 0.94
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTCAAATGGAGCTGGGTGC -3'
(R):5'- CGCCAGAAACTGCTCAAGTTGGAAG -3'

Sequencing Primer
(F):5'- GTGCATTCCGACTTGCTG -3'
(R):5'- CTGCTCAAGTTGGAAGTGGAC -3'
Posted On2013-05-09