Incidental Mutation 'R4788:Dennd4c'
ID367232
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86819963 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 994 (T994A)
Ref Sequence ENSEMBL: ENSMUSP00000039860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably benign
Transcript: ENSMUST00000045512
AA Change: T994A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: T994A

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082026
AA Change: T994A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: T994A

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121575
Predicted Effect probably benign
Transcript: ENSMUST00000142837
AA Change: T945A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: T945A

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
Predicted Primers PCR Primer
(F):5'- AAGATAGAACCGCCTTCACTCTG -3'
(R):5'- CCATGTAACTTTGCCAATGGATG -3'

Sequencing Primer
(F):5'- ATAGAACCGCCTTCACTCTGTTCTG -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2015-12-29