Incidental Mutation 'R4788:Focad'
ID 367233
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Name focadhesin
Synonyms BC057079
Accession Numbers
Essential gene? Possibly essential (E-score: 0.539) question?
Stock # R4788 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 88012866-88329248 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88275706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1105 (V1105E)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
AlphaFold A2AKG8
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: V1191E
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: V1191E

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107148
Predicted Effect unknown
Transcript: ENSMUST00000159342
AA Change: V1105E
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: V1105E

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 121,960,361 (GRCm39) D815N probably damaging Het
Abcc9 A T 6: 142,566,456 (GRCm39) C1135* probably null Het
Ap3b1 G A 13: 94,702,149 (GRCm39) M1067I unknown Het
Arhgap15 T C 2: 43,638,902 (GRCm39) M1T probably null Het
Boc T C 16: 44,320,796 (GRCm39) D288G probably damaging Het
Brsk1 G T 7: 4,701,954 (GRCm39) probably null Het
Cabp1 T C 5: 115,313,530 (GRCm39) N226S probably benign Het
Capn13 A T 17: 73,644,427 (GRCm39) Y367* probably null Het
Ccdc191 A G 16: 43,777,185 (GRCm39) E632G probably damaging Het
Cit T C 5: 116,071,565 (GRCm39) S591P probably damaging Het
Ckmt1 T C 2: 121,190,427 (GRCm39) V118A possibly damaging Het
Cndp2 T C 18: 84,693,289 (GRCm39) N157S probably damaging Het
Col6a3 A G 1: 90,700,672 (GRCm39) probably null Het
Coq2 A T 5: 100,805,775 (GRCm39) V287E probably damaging Het
Cpa6 T C 1: 10,478,502 (GRCm39) K278R possibly damaging Het
Cracdl A T 1: 37,670,556 (GRCm39) I128K probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Cyp3a25 A T 5: 145,921,892 (GRCm39) Y347* probably null Het
Dcun1d4 G T 5: 73,691,971 (GRCm39) W160L probably damaging Het
Dennd4c A G 4: 86,738,200 (GRCm39) T994A probably benign Het
Dhx57 T C 17: 80,582,760 (GRCm39) T229A probably benign Het
Dnah6 T A 6: 73,106,513 (GRCm39) R1741S probably damaging Het
Dock1 T A 7: 134,747,213 (GRCm39) V1508D probably damaging Het
Donson T C 16: 91,484,721 (GRCm39) T117A possibly damaging Het
Dtnb A G 12: 3,822,699 (GRCm39) D533G probably damaging Het
Fcrl5 A G 3: 87,364,495 (GRCm39) N470S probably damaging Het
Fry T C 5: 150,323,101 (GRCm39) V1084A probably benign Het
Gabra1 G T 11: 42,037,980 (GRCm39) R213S probably damaging Het
Gbp2b A C 3: 142,317,171 (GRCm39) K509T probably benign Het
Gprc6a T C 10: 51,491,104 (GRCm39) T811A probably benign Het
Hmgcs2 A G 3: 98,198,400 (GRCm39) D101G probably damaging Het
Ifna11 G A 4: 88,738,245 (GRCm39) W17* probably null Het
Ighv1-62-3 T A 12: 115,424,672 (GRCm39) M100L probably benign Het
Lgmn T A 12: 102,368,936 (GRCm39) Y181F probably benign Het
Map4k4 T C 1: 40,043,076 (GRCm39) S644P probably benign Het
Med9 T A 11: 59,839,266 (GRCm39) N58K probably benign Het
Nav1 C T 1: 135,397,461 (GRCm39) A903T probably benign Het
Nop53 T C 7: 15,676,240 (GRCm39) E153G possibly damaging Het
Nop56 G T 2: 130,120,820 (GRCm39) V190L probably benign Het
Nyap2 A T 1: 81,247,112 (GRCm39) M687L probably benign Het
Or4a81 G A 2: 89,619,480 (GRCm39) S72F probably damaging Het
Or8g17 T C 9: 38,930,217 (GRCm39) T207A probably benign Het
Or8g26 A G 9: 39,095,908 (GRCm39) T145A probably benign Het
Osbp2 T C 11: 3,813,320 (GRCm39) K183R probably benign Het
Pappa2 A G 1: 158,611,487 (GRCm39) V1492A possibly damaging Het
Pax1 A G 2: 147,208,124 (GRCm39) Q244R possibly damaging Het
Pcdh9 C A 14: 94,124,851 (GRCm39) V317F probably damaging Het
Pkhd1l1 A T 15: 44,361,417 (GRCm39) Q489L probably damaging Het
Poln A T 5: 34,286,675 (GRCm39) S164R probably benign Het
Ptf1a T C 2: 19,450,762 (GRCm39) S31P probably benign Het
Rasal3 A T 17: 32,618,312 (GRCm39) D164E probably benign Het
Rnf170 A G 8: 26,630,891 (GRCm39) E168G probably damaging Het
Rubcn A G 16: 32,656,778 (GRCm39) probably null Het
Sec16b A T 1: 157,389,094 (GRCm39) T830S possibly damaging Het
Sel1l3 A G 5: 53,289,175 (GRCm39) V882A probably benign Het
Sfpq A G 4: 126,919,791 (GRCm39) E512G probably damaging Het
Sh3pxd2a A G 19: 47,302,518 (GRCm39) L187P probably damaging Het
Skint6 C T 4: 113,095,533 (GRCm39) G42D possibly damaging Het
Slc7a2 A G 8: 41,367,023 (GRCm39) I526V probably benign Het
Spmip7 T C 11: 11,438,652 (GRCm39) probably null Het
Ssh2 A T 11: 77,320,624 (GRCm39) N328Y probably damaging Het
Taok2 G A 7: 126,467,304 (GRCm39) S167L possibly damaging Het
Tom1l2 A G 11: 60,139,844 (GRCm39) L275P probably damaging Het
Trgv5 A G 13: 19,376,724 (GRCm39) K57R probably benign Het
Tyrp1 C T 4: 80,763,180 (GRCm39) R356* probably null Het
Zan A G 5: 137,440,375 (GRCm39) L1953P unknown Het
Zfhx3 T C 8: 109,520,842 (GRCm39) S655P probably damaging Het
Zmym1 T C 4: 126,948,090 (GRCm39) T94A probably benign Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88,275,711 (GRCm39) missense unknown
IGL00562:Focad APN 4 88,267,046 (GRCm39) missense unknown
IGL00563:Focad APN 4 88,267,046 (GRCm39) missense unknown
IGL00900:Focad APN 4 88,047,260 (GRCm39) missense probably damaging 0.99
IGL00984:Focad APN 4 88,263,022 (GRCm39) missense unknown
IGL01016:Focad APN 4 88,310,252 (GRCm39) missense possibly damaging 0.51
IGL01069:Focad APN 4 88,244,383 (GRCm39) missense unknown
IGL01305:Focad APN 4 88,311,784 (GRCm39) missense probably benign 0.32
IGL01409:Focad APN 4 88,260,542 (GRCm39) missense unknown
IGL01447:Focad APN 4 88,244,465 (GRCm39) missense unknown
IGL01521:Focad APN 4 88,328,927 (GRCm39) makesense probably null
IGL01672:Focad APN 4 88,278,827 (GRCm39) critical splice donor site probably null
IGL01739:Focad APN 4 88,289,043 (GRCm39) missense unknown
IGL02082:Focad APN 4 88,148,815 (GRCm39) nonsense probably null
IGL02139:Focad APN 4 88,047,291 (GRCm39) critical splice donor site probably null
IGL02381:Focad APN 4 88,192,327 (GRCm39) splice site probably benign
IGL02898:Focad APN 4 88,310,234 (GRCm39) missense probably benign 0.02
certitude UTSW 4 88,096,370 (GRCm39) missense probably damaging 1.00
impression UTSW 4 88,196,479 (GRCm39) missense unknown
Microscope UTSW 4 88,260,441 (GRCm39) missense unknown
Nuance UTSW 4 88,115,083 (GRCm39) intron probably benign
Objective UTSW 4 88,319,305 (GRCm39) nonsense probably null
ANU22:Focad UTSW 4 88,311,784 (GRCm39) missense probably benign 0.32
R0025:Focad UTSW 4 88,327,196 (GRCm39) missense probably benign 0.02
R0554:Focad UTSW 4 88,267,126 (GRCm39) missense unknown
R0617:Focad UTSW 4 88,039,525 (GRCm39) unclassified probably benign
R0688:Focad UTSW 4 88,192,450 (GRCm39) missense unknown
R0746:Focad UTSW 4 88,315,451 (GRCm39) missense possibly damaging 0.84
R0907:Focad UTSW 4 88,196,498 (GRCm39) critical splice donor site probably null
R1109:Focad UTSW 4 88,114,984 (GRCm39) intron probably benign
R1136:Focad UTSW 4 88,244,417 (GRCm39) missense unknown
R1185:Focad UTSW 4 88,096,424 (GRCm39) missense probably benign 0.40
R1185:Focad UTSW 4 88,096,424 (GRCm39) missense probably benign 0.40
R1185:Focad UTSW 4 88,096,424 (GRCm39) missense probably benign 0.40
R1412:Focad UTSW 4 88,196,498 (GRCm39) critical splice donor site probably null
R1453:Focad UTSW 4 88,275,679 (GRCm39) critical splice acceptor site probably null
R1697:Focad UTSW 4 88,327,225 (GRCm39) missense probably damaging 0.98
R1739:Focad UTSW 4 88,316,128 (GRCm39) missense probably benign 0.05
R1767:Focad UTSW 4 88,275,705 (GRCm39) missense unknown
R1827:Focad UTSW 4 88,147,620 (GRCm39) missense probably benign 0.03
R1866:Focad UTSW 4 88,325,402 (GRCm39) missense possibly damaging 0.92
R1867:Focad UTSW 4 88,096,326 (GRCm39) missense probably damaging 0.99
R1929:Focad UTSW 4 88,260,449 (GRCm39) missense unknown
R1929:Focad UTSW 4 88,315,416 (GRCm39) missense probably benign 0.32
R1937:Focad UTSW 4 88,319,318 (GRCm39) start codon destroyed probably null
R1989:Focad UTSW 4 88,151,021 (GRCm39) critical splice donor site probably null
R2176:Focad UTSW 4 88,197,481 (GRCm39) missense unknown
R2393:Focad UTSW 4 88,039,567 (GRCm39) missense probably damaging 0.96
R2431:Focad UTSW 4 88,249,264 (GRCm39) missense unknown
R3195:Focad UTSW 4 88,325,588 (GRCm39) missense possibly damaging 0.85
R3196:Focad UTSW 4 88,325,588 (GRCm39) missense possibly damaging 0.85
R3730:Focad UTSW 4 88,327,162 (GRCm39) missense possibly damaging 0.52
R3772:Focad UTSW 4 88,254,398 (GRCm39) splice site probably benign
R4391:Focad UTSW 4 88,104,195 (GRCm39) missense probably damaging 1.00
R4491:Focad UTSW 4 88,278,142 (GRCm39) critical splice donor site probably null
R4492:Focad UTSW 4 88,278,142 (GRCm39) critical splice donor site probably null
R4703:Focad UTSW 4 88,260,558 (GRCm39) critical splice donor site probably null
R4923:Focad UTSW 4 88,115,083 (GRCm39) intron probably benign
R5026:Focad UTSW 4 88,262,819 (GRCm39) missense unknown
R5122:Focad UTSW 4 88,325,602 (GRCm39) critical splice donor site probably null
R5153:Focad UTSW 4 88,278,121 (GRCm39) missense unknown
R5369:Focad UTSW 4 88,039,610 (GRCm39) splice site probably benign
R5414:Focad UTSW 4 88,328,939 (GRCm39) utr 3 prime probably benign
R5839:Focad UTSW 4 88,115,083 (GRCm39) intron probably benign
R5916:Focad UTSW 4 88,275,778 (GRCm39) missense unknown
R5953:Focad UTSW 4 88,147,572 (GRCm39) missense probably benign 0.01
R5991:Focad UTSW 4 88,319,256 (GRCm39) missense possibly damaging 0.91
R6230:Focad UTSW 4 88,260,441 (GRCm39) missense unknown
R6247:Focad UTSW 4 88,325,377 (GRCm39) missense possibly damaging 0.92
R6324:Focad UTSW 4 88,319,305 (GRCm39) nonsense probably null
R6543:Focad UTSW 4 88,197,493 (GRCm39) missense unknown
R6639:Focad UTSW 4 88,196,479 (GRCm39) missense unknown
R6802:Focad UTSW 4 88,262,921 (GRCm39) missense unknown
R6802:Focad UTSW 4 88,192,440 (GRCm39) missense unknown
R6866:Focad UTSW 4 88,321,623 (GRCm39) missense probably benign 0.34
R6902:Focad UTSW 4 88,148,713 (GRCm39) missense unknown
R6928:Focad UTSW 4 88,267,112 (GRCm39) missense unknown
R7036:Focad UTSW 4 88,042,874 (GRCm39) missense probably benign 0.05
R7057:Focad UTSW 4 88,192,342 (GRCm39) missense unknown
R7077:Focad UTSW 4 88,328,914 (GRCm39) missense unknown
R7242:Focad UTSW 4 88,228,143 (GRCm39) missense unknown
R7357:Focad UTSW 4 88,147,572 (GRCm39) missense probably benign 0.19
R7380:Focad UTSW 4 88,192,435 (GRCm39) missense unknown
R7427:Focad UTSW 4 88,286,988 (GRCm39) missense unknown
R7582:Focad UTSW 4 88,147,615 (GRCm39) missense probably benign 0.00
R7661:Focad UTSW 4 88,221,772 (GRCm39) missense unknown
R7688:Focad UTSW 4 88,096,370 (GRCm39) missense probably damaging 1.00
R7789:Focad UTSW 4 88,147,643 (GRCm39) missense unknown
R7880:Focad UTSW 4 88,319,407 (GRCm39) missense unknown
R7887:Focad UTSW 4 88,100,853 (GRCm39) missense probably damaging 1.00
R8024:Focad UTSW 4 88,315,237 (GRCm39) missense unknown
R8129:Focad UTSW 4 88,151,000 (GRCm39) missense unknown
R8369:Focad UTSW 4 88,150,905 (GRCm39) missense unknown
R8837:Focad UTSW 4 88,072,905 (GRCm39) missense probably damaging 0.96
R9014:Focad UTSW 4 88,275,763 (GRCm39) missense unknown
R9282:Focad UTSW 4 88,115,059 (GRCm39) missense unknown
R9431:Focad UTSW 4 88,321,583 (GRCm39) missense unknown
R9435:Focad UTSW 4 88,267,076 (GRCm39) missense unknown
R9676:Focad UTSW 4 88,273,682 (GRCm39) missense unknown
X0035:Focad UTSW 4 88,316,159 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GATCCCCATCTAGAGCCTGTTG -3'
(R):5'- TCCCAGGAAGTGAGTCAGAC -3'

Sequencing Primer
(F):5'- CCATCTAGAGCCTGTTGTGAAAC -3'
(R):5'- TGAGTCAGACAGCAGCATGC -3'
Posted On 2015-12-29