Mutagenetix > Incidental Mutation

Incidental Mutation 'R4788:Skint6'

367235

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R4788 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 113238336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 42 (G42D)

Ref Sequence

ENSEMBL: ENSMUSP00000132312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138966
AA Change: G42D

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: G42D

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171224
AA Change: G42D

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: G42D

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 98.4%
10x: 96.9%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,631,475	I128K	probably damaging	Het
Abca4	G	A	3: 122,166,712	D815N	probably damaging	Het
Abcc9	A	T	6: 142,620,730	C1135*	probably null	Het
Ap3b1	G	A	13: 94,565,641	M1067I	unknown	Het
Arhgap15	T	C	2: 43,748,890	M1T	probably null	Het
Boc	T	C	16: 44,500,433	D288G	probably damaging	Het
Brsk1	G	T	7: 4,698,955		probably null	Het
Cabp1	T	C	5: 115,175,471	N226S	probably benign	Het
Capn13	A	T	17: 73,337,432	Y367*	probably null	Het
Ccdc191	A	G	16: 43,956,822	E632G	probably damaging	Het
Cit	T	C	5: 115,933,506	S591P	probably damaging	Het
Ckmt1	T	C	2: 121,359,946	V118A	possibly damaging	Het
Cndp2	T	C	18: 84,675,164	N157S	probably damaging	Het
Col6a3	A	G	1: 90,772,950		probably null	Het
Coq2	A	T	5: 100,657,909	V287E	probably damaging	Het
Cpa6	T	C	1: 10,408,277	K278R	possibly damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp3a25	A	T	5: 145,985,082	Y347*	probably null	Het
Dcun1d4	G	T	5: 73,534,628	W160L	probably damaging	Het
Dennd4c	A	G	4: 86,819,963	T994A	probably benign	Het
Dhx57	T	C	17: 80,275,331	T229A	probably benign	Het
Dnah6	T	A	6: 73,129,530	R1741S	probably damaging	Het
Dock1	T	A	7: 135,145,484	V1508D	probably damaging	Het
Donson	T	C	16: 91,687,833	T117A	possibly damaging	Het
Dtnb	A	G	12: 3,772,699	D533G	probably damaging	Het
Fcrl5	A	G	3: 87,457,188	N470S	probably damaging	Het
Focad	T	A	4: 88,357,469	V1105E	unknown	Het
Fry	T	C	5: 150,399,636	V1084A	probably benign	Het
Gabra1	G	T	11: 42,147,153	R213S	probably damaging	Het
Gbp2b	A	C	3: 142,611,410	K509T	probably benign	Het
Gprc6a	T	C	10: 51,615,008	T811A	probably benign	Het
Hmgcs2	A	G	3: 98,291,084	D101G	probably damaging	Het
Ifna11	G	A	4: 88,820,008	W17*	probably null	Het
Ighv1-62-3	T	A	12: 115,461,052	M100L	probably benign	Het
Lgmn	T	A	12: 102,402,677	Y181F	probably benign	Het
Map4k4	T	C	1: 40,003,916	S644P	probably benign	Het
Med9	T	A	11: 59,948,440	N58K	probably benign	Het
Nav1	C	T	1: 135,469,723	A903T	probably benign	Het
Nop53	T	C	7: 15,942,315	E153G	possibly damaging	Het
Nop56	G	T	2: 130,278,900	V190L	probably benign	Het
Nyap2	A	T	1: 81,269,397	M687L	probably benign	Het
Olfr1254	G	A	2: 89,789,136	S72F	probably damaging	Het
Olfr146	T	C	9: 39,018,921	T207A	probably benign	Het
Olfr943	A	G	9: 39,184,612	T145A	probably benign	Het
Osbp2	T	C	11: 3,863,320	K183R	probably benign	Het
Pappa2	A	G	1: 158,783,917	V1492A	possibly damaging	Het
Pax1	A	G	2: 147,366,204	Q244R	possibly damaging	Het
Pcdh9	C	A	14: 93,887,415	V317F	probably damaging	Het
Pkhd1l1	A	T	15: 44,498,021	Q489L	probably damaging	Het
Poln	A	T	5: 34,129,331	S164R	probably benign	Het
Ptf1a	T	C	2: 19,445,951	S31P	probably benign	Het
Rasal3	A	T	17: 32,399,338	D164E	probably benign	Het
Rnf170	A	G	8: 26,140,863	E168G	probably damaging	Het
Rubcn	A	G	16: 32,836,408		probably null	Het
Sec16b	A	T	1: 157,561,524	T830S	possibly damaging	Het
Sel1l3	A	G	5: 53,131,833	V882A	probably benign	Het
Sfpq	A	G	4: 127,025,998	E512G	probably damaging	Het
Sh3pxd2a	A	G	19: 47,314,079	L187P	probably damaging	Het
Slc7a2	A	G	8: 40,913,986	I526V	probably benign	Het
Spata48	T	C	11: 11,488,652		probably null	Het
Ssh2	A	T	11: 77,429,798	N328Y	probably damaging	Het
Taok2	G	A	7: 126,868,132	S167L	possibly damaging	Het
Tcrg-V5	A	G	13: 19,192,554	K57R	probably benign	Het
Tom1l2	A	G	11: 60,249,018	L275P	probably damaging	Het
Tyrp1	C	T	4: 80,844,943	R356*	probably null	Het
Zan	A	G	5: 137,442,113	L1953P	unknown	Het
Zfhx3	T	C	8: 108,794,210	S655P	probably damaging	Het
Zmym1	T	C	4: 127,054,297	T94A	probably benign	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GATCCTGAGGGTTACTTTCCC -3'
(R):5'- CAAAGTGCTCTTAAGTGGAGTG -3'

Sequencing Primer
(F):5'- CCCGATGTCATCTTTCAGGAG -3'
(R):5'- GAGTGTATGTGAATGTTTGACAGAG -3'

Posted On

2015-12-29