Incidental Mutation 'R4788:Olfr146'
ID367259
Institutional Source Beutler Lab
Gene Symbol Olfr146
Ensembl Gene ENSMUSG00000058820
Gene Nameolfactory receptor 146
SynonymsGA_x6K02T2PVTD-32715386-32714466, MOR171-10, M15
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39018073-39023377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39018921 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 207 (T207A)
Ref Sequence ENSEMBL: ENSMUSP00000149294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
Predicted Effect probably benign
Transcript: ENSMUST00000073671
AA Change: T207A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: T207A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214369
Predicted Effect probably benign
Transcript: ENSMUST00000214410
AA Change: T207A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215383
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Olfr146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Olfr146 APN 9 39018801 missense probably damaging 0.98
IGL01655:Olfr146 APN 9 39018918 missense probably benign 0.00
IGL01804:Olfr146 APN 9 39019401 missense probably benign 0.13
IGL02098:Olfr146 APN 9 39018891 missense probably damaging 1.00
IGL02719:Olfr146 APN 9 39019016 missense probably benign 0.11
R0531:Olfr146 UTSW 9 39019176 missense probably damaging 0.97
R1270:Olfr146 UTSW 9 39019247 missense possibly damaging 0.90
R1511:Olfr146 UTSW 9 39019025 missense probably benign 0.03
R1590:Olfr146 UTSW 9 39018957 missense probably benign 0.09
R1649:Olfr146 UTSW 9 39019480 missense probably benign 0.03
R3419:Olfr146 UTSW 9 39019076 missense probably benign 0.03
R4669:Olfr146 UTSW 9 39019379 missense probably benign 0.10
R5184:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R5581:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6319:Olfr146 UTSW 9 39019514 missense probably damaging 1.00
R6626:Olfr146 UTSW 9 39019106 missense possibly damaging 0.63
R6693:Olfr146 UTSW 9 39018801 missense probably damaging 0.98
R7165:Olfr146 UTSW 9 39023270 start gained probably benign
R7947:Olfr146 UTSW 9 39019451 missense probably damaging 0.99
R7957:Olfr146 UTSW 9 39019053 missense probably benign
R8052:Olfr146 UTSW 9 39019487 missense probably damaging 0.99
R8162:Olfr146 UTSW 9 39018953 missense probably benign 0.01
Z1088:Olfr146 UTSW 9 39018789 missense probably damaging 1.00
Z1191:Olfr146 UTSW 9 39018933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGATGGGTTCAGATACGTAAATCC -3'
(R):5'- ATGTTGCCATCTGTAGCCCC -3'

Sequencing Primer
(F):5'- GTTCAGATACGTAAATCCAGCAG -3'
(R):5'- GCATCATGTCTCAACATAAGTGC -3'
Posted On2015-12-29