Incidental Mutation 'R4788:Ssh2'
ID367267
Institutional Source Beutler Lab
Gene Symbol Ssh2
Ensembl Gene ENSMUSG00000037926
Gene Nameslingshot protein phosphatase 2
SynonymsSSH-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location77216287-77460220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77429798 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 328 (N328Y)
Ref Sequence ENSEMBL: ENSMUSP00000137933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]
Predicted Effect probably damaging
Transcript: ENSMUST00000037912
AA Change: N322Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: N322Y

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:DEK_C 251 302 3.1e-13 PFAM
DSPc 307 445 2.2e-41 SMART
low complexity region 459 469 N/A INTRINSIC
low complexity region 871 882 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180554
Predicted Effect probably damaging
Transcript: ENSMUST00000181283
AA Change: N328Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: N328Y

DomainStartEndE-ValueType
Pfam:DEK_C 256 309 1.7e-18 PFAM
DSPc 313 451 2.2e-41 SMART
low complexity region 465 475 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1376 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Ssh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Ssh2 APN 11 77441926 missense probably damaging 1.00
IGL01141:Ssh2 APN 11 77449726 missense probably damaging 1.00
IGL01520:Ssh2 APN 11 77449906 missense probably damaging 1.00
IGL01803:Ssh2 APN 11 77425330 missense probably damaging 0.99
IGL01989:Ssh2 APN 11 77453685 missense possibly damaging 0.79
IGL02322:Ssh2 APN 11 77416413 critical splice acceptor site probably null
IGL02466:Ssh2 APN 11 77416407 splice site probably benign
IGL02683:Ssh2 APN 11 77398256 missense probably damaging 0.99
IGL02706:Ssh2 APN 11 77453406 missense possibly damaging 0.68
IGL02719:Ssh2 APN 11 77425587 missense probably damaging 1.00
IGL02721:Ssh2 APN 11 77454725 nonsense probably null
IGL02732:Ssh2 APN 11 77437776 splice site probably null
IGL02745:Ssh2 APN 11 77455407 missense probably damaging 1.00
IGL02993:Ssh2 APN 11 77453544 missense probably damaging 1.00
IGL03000:Ssh2 APN 11 77421206 splice site probably benign
david UTSW 11 77425593 missense probably damaging 1.00
faba UTSW 11 77441985 missense probably damaging 1.00
goliath UTSW 11 77453523 missense possibly damaging 0.48
Vicia UTSW 11 77454966 missense possibly damaging 0.68
IGL03055:Ssh2 UTSW 11 77408195 nonsense probably null
R0024:Ssh2 UTSW 11 77454966 missense possibly damaging 0.68
R0374:Ssh2 UTSW 11 77408143 missense probably damaging 1.00
R0539:Ssh2 UTSW 11 77454794 missense probably benign 0.11
R0834:Ssh2 UTSW 11 77437633 missense possibly damaging 0.87
R1714:Ssh2 UTSW 11 77454024 missense possibly damaging 0.94
R1743:Ssh2 UTSW 11 77437756 missense probably damaging 1.00
R1889:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R1895:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R3945:Ssh2 UTSW 11 77454668 missense possibly damaging 0.93
R3947:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R3948:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R4133:Ssh2 UTSW 11 77421269 missense probably damaging 1.00
R4256:Ssh2 UTSW 11 77408183 missense possibly damaging 0.48
R4499:Ssh2 UTSW 11 77393067 nonsense probably null
R4548:Ssh2 UTSW 11 77450184 missense probably benign 0.20
R4644:Ssh2 UTSW 11 77449576 missense possibly damaging 0.46
R4690:Ssh2 UTSW 11 77455205 missense possibly damaging 0.62
R4919:Ssh2 UTSW 11 77425320 missense possibly damaging 0.91
R5014:Ssh2 UTSW 11 77455276 nonsense probably null
R5380:Ssh2 UTSW 11 77453945 missense probably benign 0.01
R5574:Ssh2 UTSW 11 77450115 missense probably benign
R5593:Ssh2 UTSW 11 77421366 missense probably damaging 0.99
R5739:Ssh2 UTSW 11 77449813 missense probably damaging 1.00
R6180:Ssh2 UTSW 11 77453465 missense probably benign 0.43
R6542:Ssh2 UTSW 11 77450150 missense possibly damaging 0.94
R6713:Ssh2 UTSW 11 77449433 missense possibly damaging 0.89
R7108:Ssh2 UTSW 11 77454794 missense probably benign
R7124:Ssh2 UTSW 11 77454338 missense probably benign 0.00
R7255:Ssh2 UTSW 11 77425593 missense probably damaging 1.00
R7332:Ssh2 UTSW 11 77453523 missense possibly damaging 0.48
R7362:Ssh2 UTSW 11 77449650 missense probably benign 0.01
R7395:Ssh2 UTSW 11 77393073 missense probably damaging 0.99
R7412:Ssh2 UTSW 11 77450108 missense probably damaging 0.98
R7493:Ssh2 UTSW 11 77437716 missense probably benign 0.16
R7686:Ssh2 UTSW 11 77425324 missense possibly damaging 0.89
R7870:Ssh2 UTSW 11 77453615 missense probably benign
R7895:Ssh2 UTSW 11 77454626 missense probably benign 0.41
R7963:Ssh2 UTSW 11 77421356 missense possibly damaging 0.93
R8030:Ssh2 UTSW 11 77454506 missense probably benign 0.01
R8065:Ssh2 UTSW 11 77441985 missense probably damaging 1.00
R8099:Ssh2 UTSW 11 77454929 nonsense probably null
R8294:Ssh2 UTSW 11 77454201 missense probably benign 0.08
R8464:Ssh2 UTSW 11 77454253 nonsense probably null
R8469:Ssh2 UTSW 11 77449608 missense probably benign 0.41
R8547:Ssh2 UTSW 11 77449707 missense probably benign 0.10
R8677:Ssh2 UTSW 11 77455193 missense possibly damaging 0.77
R8758:Ssh2 UTSW 11 77454017 missense probably benign
RF018:Ssh2 UTSW 11 77454054 missense probably damaging 0.99
X0017:Ssh2 UTSW 11 77441898 missense probably damaging 1.00
Z1088:Ssh2 UTSW 11 77449495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACCCAGGAAAAGATAATTTCTTG -3'
(R):5'- CTCATCTTTCTTGGGCGGGAAG -3'

Sequencing Primer
(F):5'- GTTCCTGGTATTAAGAGGC -3'
(R):5'- CTTGGGCGGGAAGATGATC -3'
Posted On2015-12-29