Incidental Mutation 'R0412:Gpr179'
ID36728
Institutional Source Beutler Lab
Gene Symbol Gpr179
Ensembl Gene ENSMUSG00000070337
Gene NameG protein-coupled receptor 179
Synonyms5330439C02Rik
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0412 (G1)
Quality Score198
Status Validated
Chromosome11
Chromosomal Location97332109-97352077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97338807 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 841 (S841P)
Ref Sequence ENSEMBL: ENSMUSP00000091474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093942]
Predicted Effect probably damaging
Transcript: ENSMUST00000093942
AA Change: S841P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: S841P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 41 N/A INTRINSIC
EGF 281 357 1.91e1 SMART
Pfam:7tm_3 391 633 3.2e-40 PFAM
low complexity region 735 759 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 959 988 N/A INTRINSIC
low complexity region 1107 1125 N/A INTRINSIC
internal_repeat_2 1156 1467 1.99e-12 PROSPERO
internal_repeat_1 1235 1674 2.85e-27 PROSPERO
internal_repeat_2 1569 1879 1.99e-12 PROSPERO
internal_repeat_1 1756 2284 2.85e-27 PROSPERO
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Gpr179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Gpr179 APN 11 97337801 missense probably damaging 0.99
IGL01152:Gpr179 APN 11 97337411 missense probably benign 0.08
IGL01402:Gpr179 APN 11 97338186 nonsense probably null
IGL01404:Gpr179 APN 11 97338186 nonsense probably null
IGL01773:Gpr179 APN 11 97341366 missense probably benign 0.05
IGL02682:Gpr179 APN 11 97351865 missense probably benign
IGL02728:Gpr179 APN 11 97337900 missense probably damaging 0.99
IGL03243:Gpr179 APN 11 97351475 missense probably benign 0.02
IGL03272:Gpr179 APN 11 97336593 missense possibly damaging 0.89
IGL03347:Gpr179 APN 11 97351838 missense probably damaging 1.00
IGL03355:Gpr179 APN 11 97337608 missense possibly damaging 0.57
PIT4280001:Gpr179 UTSW 11 97344115 missense probably damaging 1.00
PIT4366001:Gpr179 UTSW 11 97336851 missense probably benign
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0080:Gpr179 UTSW 11 97351469 missense probably benign 0.08
R0255:Gpr179 UTSW 11 97336066 missense probably benign 0.24
R0481:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R0612:Gpr179 UTSW 11 97338438 missense possibly damaging 0.86
R0786:Gpr179 UTSW 11 97343274 missense probably damaging 1.00
R1753:Gpr179 UTSW 11 97346578 missense probably damaging 1.00
R1761:Gpr179 UTSW 11 97335106 missense probably benign 0.00
R1796:Gpr179 UTSW 11 97336556 missense possibly damaging 0.86
R1969:Gpr179 UTSW 11 97337958 missense probably benign
R2240:Gpr179 UTSW 11 97351733 missense probably damaging 1.00
R3855:Gpr179 UTSW 11 97341434 missense probably damaging 1.00
R3913:Gpr179 UTSW 11 97334765 missense probably benign 0.01
R4484:Gpr179 UTSW 11 97335711 missense probably benign 0.28
R4806:Gpr179 UTSW 11 97349784 missense possibly damaging 0.55
R4816:Gpr179 UTSW 11 97339248 missense probably damaging 0.99
R4906:Gpr179 UTSW 11 97346661 missense possibly damaging 0.87
R4945:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R5191:Gpr179 UTSW 11 97338149 missense possibly damaging 0.76
R5273:Gpr179 UTSW 11 97347430 missense probably damaging 1.00
R5317:Gpr179 UTSW 11 97337845 missense probably damaging 1.00
R5459:Gpr179 UTSW 11 97336657 missense probably benign 0.00
R5507:Gpr179 UTSW 11 97338330 missense probably damaging 1.00
R5523:Gpr179 UTSW 11 97336782 missense probably benign 0.37
R5536:Gpr179 UTSW 11 97343815 missense probably damaging 1.00
R5591:Gpr179 UTSW 11 97345755 missense probably benign 0.17
R5679:Gpr179 UTSW 11 97336745 missense probably benign 0.20
R5738:Gpr179 UTSW 11 97351406 missense probably damaging 1.00
R5829:Gpr179 UTSW 11 97335698 missense probably benign 0.11
R5836:Gpr179 UTSW 11 97339056 missense probably benign 0.03
R6007:Gpr179 UTSW 11 97335802 nonsense probably null
R6047:Gpr179 UTSW 11 97338416 missense probably damaging 1.00
R6339:Gpr179 UTSW 11 97344176 missense probably damaging 1.00
R6383:Gpr179 UTSW 11 97337147 missense possibly damaging 0.88
R6674:Gpr179 UTSW 11 97347405 critical splice donor site probably null
R6712:Gpr179 UTSW 11 97336167 missense possibly damaging 0.94
R6835:Gpr179 UTSW 11 97347467 missense probably damaging 1.00
R6980:Gpr179 UTSW 11 97334858 missense probably benign 0.38
R7044:Gpr179 UTSW 11 97349790 missense probably benign 0.19
R7121:Gpr179 UTSW 11 97334730 missense probably benign 0.00
R7307:Gpr179 UTSW 11 97338846 missense probably benign 0.36
R7406:Gpr179 UTSW 11 97351594 missense probably damaging 0.99
R7467:Gpr179 UTSW 11 97335289 missense probably benign 0.02
R7477:Gpr179 UTSW 11 97335839 missense possibly damaging 0.87
R7725:Gpr179 UTSW 11 97351292 missense probably damaging 1.00
R8028:Gpr179 UTSW 11 97337801 missense probably damaging 0.99
R8165:Gpr179 UTSW 11 97351538 missense probably benign 0.12
R8262:Gpr179 UTSW 11 97336157 missense probably benign 0.00
R8674:Gpr179 UTSW 11 97335047 missense probably benign 0.00
R8695:Gpr179 UTSW 11 97336298 missense possibly damaging 0.59
R8731:Gpr179 UTSW 11 97343729 missense probably damaging 1.00
R8791:Gpr179 UTSW 11 97351913 missense probably damaging 1.00
X0065:Gpr179 UTSW 11 97347438 missense probably benign 0.08
Z1176:Gpr179 UTSW 11 97336648 missense probably benign 0.05
Z1177:Gpr179 UTSW 11 97351239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTCTTGGCTCTCCCAGGCAG -3'
(R):5'- AGGGAACATAACACTCTCCCCTTCG -3'

Sequencing Primer
(F):5'- AGAGCTGTCCATGCTGCTG -3'
(R):5'- TTCGACTCCACGCTGAGAC -3'
Posted On2013-05-09