Mutagenetix > Incidental Mutations

Incidental Mutation 'R0412:Ddx41'

36729

Institutional Source

Beutler Lab

Gene Symbol

Ddx41

Ensembl Gene

ENSMUSG00000021494

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 41

Synonyms

2900024F02Rik

MMRRC Submission

038614-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0412 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

55530410-55536658 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 55530608 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 630 (S630Y)

Ref Sequence

ENSEMBL: ENSMUSP00000153348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000047877] [ENSMUST00000223563] [ENSMUST00000224765]

AlphaFold

Q91VN6

Predicted Effect

probably damaging
Transcript: ENSMUST00000021956
AA Change: S619Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: S619Y

Domain	Start	End	E-Value	Type
low complexity region	24	32	N/A	INTRINSIC
low complexity region	39	56	N/A	INTRINSIC
low complexity region	95	115	N/A	INTRINSIC
DEXDc	200	411	8.56e-53	SMART
HELICc	446	527	5.99e-34	SMART
ZnF_C2HC	581	597	1.98e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000047877

SMART Domains

Protein: ENSMUSP00000046695
Gene: ENSMUSG00000035711

Domain	Start	End	E-Value	Type
PH	7	125	3.54e-5	SMART
IRS	157	256	1.61e-41	SMART
PTBI	158	256	2.59e-24	SMART
low complexity region	273	284	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	358	376	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224686

Predicted Effect

probably damaging
Transcript: ENSMUST00000224765
AA Change: S630Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225783

Meta Mutation Damage Score

0.0935

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.2%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	C	G	7: 29,530,570		noncoding transcript	Het
Arap1	C	A	7: 101,390,222	A563D	probably damaging	Het
Arhgap28	G	A	17: 67,896,258	L67F	probably damaging	Het
Atp7b	G	T	8: 21,995,659		probably null	Het
Auts2	A	G	5: 131,446,831	F485L	probably benign	Het
Ccdc68	A	G	18: 69,960,439	E239G	probably damaging	Het
Cdc42bpg	T	G	19: 6,313,457	L449R	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Dntt	T	C	19: 41,042,933	L274P	probably damaging	Het
Fhl4	G	T	10: 85,098,816	H34N	possibly damaging	Het
Filip1	A	T	9: 79,820,289	N349K	possibly damaging	Het
Gm9894	C	T	13: 67,765,026		noncoding transcript	Het
Gpr179	A	G	11: 97,338,807	S841P	probably damaging	Het
Gpr35	G	T	1: 92,982,784	V73L	probably benign	Het
Grik5	A	G	7: 25,013,674	V809A	possibly damaging	Het
H2-Bl	T	A	17: 36,081,521		probably benign	Het
Heatr5b	T	C	17: 78,820,854	T451A	probably benign	Het
Hmcn2	G	A	2: 31,388,247	V1654M	probably damaging	Het
Htra3	G	T	5: 35,671,065	A157E	probably damaging	Het
Igf2r	A	T	17: 12,683,948	V2405D	probably damaging	Het
Irs3	C	A	5: 137,643,877	R433L	probably benign	Het
Kcmf1	G	A	6: 72,848,241	Q239*	probably null	Het
Kcnk9	A	G	15: 72,513,056		probably benign	Het
Kif28	A	G	1: 179,702,526	V622A	probably benign	Het
Klrb1f	A	T	6: 129,054,331	I164F	probably benign	Het
Lama2	A	G	10: 27,190,625	S1087P	possibly damaging	Het
Mchr1	A	T	15: 81,235,747		probably benign	Het
Mcidas	A	G	13: 112,999,143	T367A	probably damaging	Het
Mphosph8	A	C	14: 56,674,413	K298Q	probably damaging	Het
Mroh2a	G	T	1: 88,235,216	Q360H	probably benign	Het
Mst1	A	C	9: 108,083,594	D461A	probably benign	Het
Nckap1l	A	T	15: 103,464,652	S311C	probably benign	Het
Olfr1036	C	T	2: 86,075,091	A117V	probably benign	Het
Olfr1233	T	A	2: 89,340,078	M75L	probably benign	Het
Olfr1385	T	A	11: 49,494,767	V78E	probably damaging	Het
Olfr251	A	C	9: 38,378,794	K298N	probably damaging	Het
Pde3a	T	G	6: 141,498,684	C1073G	probably damaging	Het
Pkhd1	T	C	1: 20,117,788	D3432G	probably damaging	Het
Ppargc1b	G	T	18: 61,315,861	P130Q	probably damaging	Het
Ppp6r1	A	G	7: 4,642,214	I228T	probably damaging	Het
Pram1	A	G	17: 33,641,506	N349S	probably benign	Het
Ranbp6	C	T	19: 29,812,083	V290I	possibly damaging	Het
Rcan3	A	T	4: 135,416,603		probably null	Het
Scn8a	G	C	15: 101,008,306		probably benign	Het
Slc12a5	C	T	2: 164,994,062	T900M	probably benign	Het
Srsf10	A	G	4: 135,858,403	Y55C	probably damaging	Het
Syt7	G	T	19: 10,444,080	E450*	probably null	Het
Tbrg4	T	C	11: 6,623,832	K130R	probably benign	Het
Tgm7	C	A	2: 121,101,065	V206F	probably damaging	Het
Tmem131l	T	C	3: 84,031,648	D67G	probably damaging	Het
Ttc7	A	G	17: 87,330,044	K409R	probably benign	Het
Unc80	A	T	1: 66,550,937		probably benign	Het
Vmn1r171	C	T	7: 23,632,655	L102F	possibly damaging	Het
Vmn2r59	A	C	7: 42,046,492		probably benign	Het
Vsig2	A	G	9: 37,542,690	R191G	probably damaging	Het
Wdr86	T	A	5: 24,718,234	Q153H	probably benign	Het
Xxylt1	T	A	16: 31,007,798	N233I	probably damaging	Het
Zfp160	A	T	17: 21,026,877	E563V	probably damaging	Het
Zfp345	T	A	2: 150,473,403	E71D	probably benign	Het
Zfp541	A	G	7: 16,082,174	D862G	possibly damaging	Het
Zfp639	A	C	3: 32,517,110	Q47P	possibly damaging	Het

Other mutations in Ddx41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ddx41	APN	13	55531399	missense	probably damaging	1.00
IGL00516:Ddx41	APN	13	55532467	missense	probably damaging	0.96
IGL02383:Ddx41	APN	13	55532357	missense	probably benign	0.04
R0081:Ddx41	UTSW	13	55535380	missense	possibly damaging	0.58
R0097:Ddx41	UTSW	13	55535878	splice site	probably benign
R0597:Ddx41	UTSW	13	55533006	missense	probably damaging	1.00
R0699:Ddx41	UTSW	13	55531299	splice site	probably benign
R1330:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R1812:Ddx41	UTSW	13	55535954	missense	probably benign	0.03
R2011:Ddx41	UTSW	13	55534093	splice site	probably null
R2224:Ddx41	UTSW	13	55531401	missense	probably damaging	1.00
R2310:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R2311:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R2355:Ddx41	UTSW	13	55534300	missense	probably benign	0.03
R2983:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3032:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3764:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3773:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3916:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3926:Ddx41	UTSW	13	55531270	missense	probably damaging	1.00
R4153:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4154:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4372:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4470:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4519:Ddx41	UTSW	13	55533144	missense	probably damaging	1.00
R4569:Ddx41	UTSW	13	55536021	missense	possibly damaging	0.88
R4823:Ddx41	UTSW	13	55532055	missense	probably benign	0.02
R4837:Ddx41	UTSW	13	55531648	missense	possibly damaging	0.95
R5443:Ddx41	UTSW	13	55535291	missense	probably benign	0.00
R5642:Ddx41	UTSW	13	55535895	missense	possibly damaging	0.86
R5926:Ddx41	UTSW	13	55534299	missense	probably damaging	0.99
R5949:Ddx41	UTSW	13	55532061	missense	probably damaging	1.00
R6035:Ddx41	UTSW	13	55533968	missense	probably benign	0.00
R6035:Ddx41	UTSW	13	55533968	missense	probably benign	0.00
R7254:Ddx41	UTSW	13	55533956	nonsense	probably null
R7640:Ddx41	UTSW	13	55534239	missense	possibly damaging	0.81
R7803:Ddx41	UTSW	13	55531921	missense	probably damaging	1.00
R8690:Ddx41	UTSW	13	55533126	missense	probably damaging	1.00
R8714:Ddx41	UTSW	13	55534437	missense	probably damaging	1.00
R9071:Ddx41	UTSW	13	55532406	missense	probably damaging	0.96
R9089:Ddx41	UTSW	13	55535611	missense	probably benign	0.05
R9312:Ddx41	UTSW	13	55536029	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTCCTGACCAGATACCCTGAGCC -3'
(R):5'- CCTGAAACTTGGTCCTGTGACCTTG -3'

Sequencing Primer
(F):5'- CTATAGGAGGCTGGCAACTCTG -3'
(R):5'- GGTCCTGTGACCTTGCTGAC -3'

Posted On

2013-05-09