Incidental Mutation 'R4789:Add2'
ID367312
Institutional Source Beutler Lab
Gene Symbol Add2
Ensembl Gene ENSMUSG00000030000
Gene Nameadducin 2 (beta)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86028681-86124409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86118770 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 475 (V475M)
Ref Sequence ENSEMBL: ENSMUSP00000145452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032069] [ENSMUST00000203279] [ENSMUST00000203724] [ENSMUST00000203786] [ENSMUST00000204059]
Predicted Effect unknown
Transcript: ENSMUST00000032069
AA Change: V723M
SMART Domains Protein: ENSMUSP00000032069
Gene: ENSMUSG00000030000
AA Change: V723M

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203279
AA Change: V475M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145452
Gene: ENSMUSG00000030000
AA Change: V475M

DomainStartEndE-ValueType
Aldolase_II 135 289 1.77e-20 SMART
coiled coil region 310 337 N/A INTRINSIC
low complexity region 439 477 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203724
AA Change: V723M
SMART Domains Protein: ENSMUSP00000145296
Gene: ENSMUSG00000030000
AA Change: V723M

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203786
AA Change: V723M
SMART Domains Protein: ENSMUSP00000144694
Gene: ENSMUSG00000030000
AA Change: V723M

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204059
AA Change: V723M
SMART Domains Protein: ENSMUSP00000145160
Gene: ENSMUSG00000030000
AA Change: V723M

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the adducin family. Adducins, encoded by alpha, beta and gamma genes, are heteromeric proteins that crosslink actin filaments with spectrin at the cytoskeletal membrane. This protein, primarily found in the brain and hematopoietic cells, is regulated by phosphorylation and calmodulin interactions as it promotes spectrin assembly onto actin filaments, bundles actin and caps barbed ends of actin filaments. In mouse, deficiency of this gene can lead to mild hemolytic anemia and impaired synaptic plasticity. Mutations of this gene in mouse serve as a pathophysiological model for hereditary spherocytosis and hereditary elliptocytosis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display mild anemia with compensated hemolysis, marked alteration in osmotic fragility, predominant presence of elliptocytes in the blood and increased blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Add2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:Add2 APN 6 86107406 missense possibly damaging 0.94
IGL02799:Add2 UTSW 6 86106252 missense possibly damaging 0.65
R0012:Add2 UTSW 6 86098628 missense probably damaging 0.98
R0448:Add2 UTSW 6 86092919 missense probably benign 0.05
R0452:Add2 UTSW 6 86104629 nonsense probably null
R0834:Add2 UTSW 6 86086917 missense probably damaging 0.99
R1220:Add2 UTSW 6 86087000 missense possibly damaging 0.92
R1598:Add2 UTSW 6 86098646 missense probably benign 0.03
R1806:Add2 UTSW 6 86118657 missense probably damaging 0.96
R1837:Add2 UTSW 6 86118558 missense probably damaging 1.00
R1959:Add2 UTSW 6 86096756 missense probably damaging 1.00
R1961:Add2 UTSW 6 86096756 missense probably damaging 1.00
R2152:Add2 UTSW 6 86098598 missense probably damaging 1.00
R2309:Add2 UTSW 6 86096801 missense probably damaging 1.00
R4744:Add2 UTSW 6 86110888 missense probably damaging 1.00
R4896:Add2 UTSW 6 86096746 missense probably benign 0.03
R4989:Add2 UTSW 6 86110858 missense probably benign 0.10
R5004:Add2 UTSW 6 86096746 missense probably benign 0.03
R5061:Add2 UTSW 6 86087047 splice site probably null
R5068:Add2 UTSW 6 86107458 missense probably damaging 0.97
R5405:Add2 UTSW 6 86101197 missense probably benign 0.09
R5418:Add2 UTSW 6 86110912 missense probably benign 0.00
R5576:Add2 UTSW 6 86107475 critical splice donor site probably null
R5952:Add2 UTSW 6 86109746 missense probably damaging 1.00
R6011:Add2 UTSW 6 86098625 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R7026:Add2 UTSW 6 86086983 missense probably benign 0.39
R7158:Add2 UTSW 6 86085952 missense probably damaging 1.00
R7387:Add2 UTSW 6 86086015 missense probably damaging 1.00
R7393:Add2 UTSW 6 86098647 nonsense probably null
R7487:Add2 UTSW 6 86093450 missense possibly damaging 0.94
R7511:Add2 UTSW 6 86098615 missense probably benign
R7543:Add2 UTSW 6 86106225 missense probably damaging 1.00
Z1088:Add2 UTSW 6 86085965 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGCCTGAGCCAGTGAAAC -3'
(R):5'- TCCTAACATAGGCAGCCCAG -3'

Sequencing Primer
(F):5'- AGGCCCTCAGCAAAGGACTG -3'
(R):5'- GCTGCCAACTAACTGTGACTATGG -3'
Posted On2015-12-29