Incidental Mutation 'R0412:Mphosph8'
ID36732
Institutional Source Beutler Lab
Gene Symbol Mphosph8
Ensembl Gene ENSMUSG00000079184
Gene NameM-phase phosphoprotein 8
Synonyms4930548G07Rik, 1500035L22Rik
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R0412 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56668248-56697430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 56674413 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 298 (K298Q)
Ref Sequence ENSEMBL: ENSMUSP00000112170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116468]
Predicted Effect probably damaging
Transcript: ENSMUST00000116468
AA Change: K298Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112170
Gene: ENSMUSG00000079184
AA Change: K298Q

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
CHROMO 58 111 6.2e-13 SMART
low complexity region 152 160 N/A INTRINSIC
coiled coil region 226 256 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
Blast:ANK 563 592 1e-7 BLAST
ANK 598 627 4.43e-2 SMART
ANK 631 660 5.45e-2 SMART
ANK 664 693 1.08e-5 SMART
Blast:ANK 697 726 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130246
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Mphosph8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Mphosph8 APN 14 56674443 missense probably benign 0.00
IGL00786:Mphosph8 APN 14 56672544 missense probably benign 0.00
IGL01635:Mphosph8 APN 14 56672546 missense probably damaging 0.99
IGL02104:Mphosph8 APN 14 56674579 missense probably benign 0.02
IGL02387:Mphosph8 APN 14 56695721 missense probably damaging 1.00
IGL02486:Mphosph8 APN 14 56688387 missense possibly damaging 0.80
IGL02547:Mphosph8 APN 14 56672484 missense probably damaging 1.00
IGL02578:Mphosph8 APN 14 56674210 missense probably benign
IGL03247:Mphosph8 APN 14 56678820 critical splice donor site probably null
IGL03377:Mphosph8 APN 14 56693486 missense probably damaging 1.00
R0647:Mphosph8 UTSW 14 56674405 missense probably benign
R1079:Mphosph8 UTSW 14 56674259 missense probably damaging 1.00
R1451:Mphosph8 UTSW 14 56668421 missense possibly damaging 0.62
R1486:Mphosph8 UTSW 14 56689039 missense probably damaging 1.00
R1687:Mphosph8 UTSW 14 56672478 missense probably damaging 1.00
R1733:Mphosph8 UTSW 14 56693459 missense probably damaging 1.00
R1809:Mphosph8 UTSW 14 56672452 missense probably damaging 1.00
R1844:Mphosph8 UTSW 14 56697159 missense probably damaging 1.00
R2132:Mphosph8 UTSW 14 56678704 missense probably benign 0.04
R4242:Mphosph8 UTSW 14 56674314 missense probably benign 0.00
R4261:Mphosph8 UTSW 14 56674465 missense probably benign 0.00
R4563:Mphosph8 UTSW 14 56691000 missense probably benign 0.00
R4962:Mphosph8 UTSW 14 56678589 missense probably benign 0.27
R5121:Mphosph8 UTSW 14 56676546 nonsense probably null
R6082:Mphosph8 UTSW 14 56668541 missense probably damaging 1.00
R6224:Mphosph8 UTSW 14 56668353 start codon destroyed probably null
R6455:Mphosph8 UTSW 14 56688486 missense probably damaging 1.00
R7086:Mphosph8 UTSW 14 56668523 missense possibly damaging 0.94
R7236:Mphosph8 UTSW 14 56674297 missense possibly damaging 0.63
R7266:Mphosph8 UTSW 14 56685040 missense possibly damaging 0.89
R7564:Mphosph8 UTSW 14 56674038 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATAGCGACCAGCAAAGTGACAC -3'
(R):5'- CTTTTCAGGGTTTGGGCAAACACAG -3'

Sequencing Primer
(F):5'- TGGAGAGCACCTCTGAAATAATC -3'
(R):5'- GGTATTGCTCTCCTTTCTAAAAAGGC -3'
Posted On2013-05-09