Incidental Mutation 'R0412:Nckap1l'
ID36735
Institutional Source Beutler Lab
Gene Symbol Nckap1l
Ensembl Gene ENSMUSG00000022488
Gene NameNCK associated protein 1 like
SynonymsHem1, 4930568P13Rik
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R0412 (G1)
Quality Score224
Status Validated
Chromosome15
Chromosomal Location103453794-103498810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103464652 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 311 (S311C)
Ref Sequence ENSEMBL: ENSMUSP00000035400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047405] [ENSMUST00000229127]
Predicted Effect probably benign
Transcript: ENSMUST00000047405
AA Change: S311C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035400
Gene: ENSMUSG00000022488
AA Change: S311C

DomainStartEndE-ValueType
Pfam:Nckap1 7 1123 N/A PFAM
Predicted Effect silent
Transcript: ENSMUST00000229127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229468
Meta Mutation Damage Score 0.1752 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Nckap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Nckap1l APN 15 103462720 missense probably benign 0.42
IGL01818:Nckap1l APN 15 103478282 missense probably damaging 1.00
IGL01912:Nckap1l APN 15 103474146 missense probably benign 0.15
IGL01945:Nckap1l APN 15 103461642 missense probably damaging 1.00
IGL01947:Nckap1l APN 15 103491015 missense probably benign 0.32
IGL02218:Nckap1l APN 15 103483527 missense possibly damaging 0.47
IGL02317:Nckap1l APN 15 103461578 missense probably benign 0.05
IGL02376:Nckap1l APN 15 103471231 missense possibly damaging 0.95
IGL03263:Nckap1l APN 15 103464405 missense probably damaging 1.00
hem-haw UTSW 15 103471232 nonsense probably null
Sinstral UTSW 15 103483613 missense probably benign
stammer UTSW 15 103473821 missense possibly damaging 0.79
stutter UTSW 15 103476099 critical splice donor site probably null
tentative UTSW 15 103474159 missense probably damaging 0.98
IGL02802:Nckap1l UTSW 15 103464536 missense probably benign 0.03
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0114:Nckap1l UTSW 15 103455028 missense probably benign
R0137:Nckap1l UTSW 15 103481964 missense probably benign 0.01
R0375:Nckap1l UTSW 15 103474159 missense probably damaging 0.98
R0390:Nckap1l UTSW 15 103453883 missense probably damaging 1.00
R0467:Nckap1l UTSW 15 103497427 missense probably benign 0.02
R1245:Nckap1l UTSW 15 103455925 missense probably damaging 1.00
R1592:Nckap1l UTSW 15 103482180 critical splice donor site probably null
R1593:Nckap1l UTSW 15 103478854 missense probably null 0.00
R1879:Nckap1l UTSW 15 103464601 missense probably benign
R2081:Nckap1l UTSW 15 103497454 missense probably damaging 0.98
R2144:Nckap1l UTSW 15 103475676 missense probably damaging 0.96
R2228:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2229:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2411:Nckap1l UTSW 15 103483568 missense probably damaging 1.00
R3965:Nckap1l UTSW 15 103464589 nonsense probably null
R3971:Nckap1l UTSW 15 103462560 missense probably damaging 1.00
R4270:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R4348:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4351:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4748:Nckap1l UTSW 15 103473056 missense probably damaging 1.00
R4918:Nckap1l UTSW 15 103483613 missense probably benign
R5230:Nckap1l UTSW 15 103483639 missense probably benign 0.30
R5595:Nckap1l UTSW 15 103475658 missense possibly damaging 0.57
R5642:Nckap1l UTSW 15 103455025 missense probably benign 0.00
R5701:Nckap1l UTSW 15 103472768 missense probably benign 0.34
R6000:Nckap1l UTSW 15 103478815 missense probably benign 0.07
R6229:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R6367:Nckap1l UTSW 15 103475722 missense probably benign 0.00
R6420:Nckap1l UTSW 15 103491466 missense possibly damaging 0.89
R6440:Nckap1l UTSW 15 103471232 nonsense probably null
R6957:Nckap1l UTSW 15 103491511 missense possibly damaging 0.91
R7023:Nckap1l UTSW 15 103476066 missense probably benign 0.11
R7083:Nckap1l UTSW 15 103482124 missense probably damaging 1.00
R7360:Nckap1l UTSW 15 103476099 critical splice donor site probably null
R7361:Nckap1l UTSW 15 103471282 missense possibly damaging 0.79
R7457:Nckap1l UTSW 15 103453806 start gained probably benign
R7582:Nckap1l UTSW 15 103482160 missense probably damaging 1.00
R7662:Nckap1l UTSW 15 103462585 missense probably damaging 0.99
R7699:Nckap1l UTSW 15 103462821 splice site probably null
R7951:Nckap1l UTSW 15 103473115 missense probably damaging 1.00
R8059:Nckap1l UTSW 15 103493287 missense possibly damaging 0.87
R8124:Nckap1l UTSW 15 103473821 missense possibly damaging 0.79
R8152:Nckap1l UTSW 15 103478530 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGATGGCCTGTGAGTATCTGTCCG -3'
(R):5'- CTCTCTCGAAAACCCAGTGAGGCAC -3'

Sequencing Primer
(F):5'- TCATAAGTAAGTTGTAGGAGCACC -3'
(R):5'- TGAGGCACCAACCAAGAGTAG -3'
Posted On2013-05-09