Mutagenetix > Incidental Mutations

Incidental Mutation 'R0412:Igf2r'

36737

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

038614-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R0412 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12683948 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 2405 (V2405D)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: V2405D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: V2405D

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.2774

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.2%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	C	G	7: 29,530,570		noncoding transcript	Het
Arap1	C	A	7: 101,390,222	A563D	probably damaging	Het
Arhgap28	G	A	17: 67,896,258	L67F	probably damaging	Het
Atp7b	G	T	8: 21,995,659		probably null	Het
Auts2	A	G	5: 131,446,831	F485L	probably benign	Het
Ccdc68	A	G	18: 69,960,439	E239G	probably damaging	Het
Cdc42bpg	T	G	19: 6,313,457	L449R	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Ddx41	G	T	13: 55,530,608	S630Y	probably damaging	Het
Dntt	T	C	19: 41,042,933	L274P	probably damaging	Het
Fhl4	G	T	10: 85,098,816	H34N	possibly damaging	Het
Filip1	A	T	9: 79,820,289	N349K	possibly damaging	Het
Gm9894	C	T	13: 67,765,026		noncoding transcript	Het
Gpr179	A	G	11: 97,338,807	S841P	probably damaging	Het
Gpr35	G	T	1: 92,982,784	V73L	probably benign	Het
Grik5	A	G	7: 25,013,674	V809A	possibly damaging	Het
H2-Bl	T	A	17: 36,081,521		probably benign	Het
Heatr5b	T	C	17: 78,820,854	T451A	probably benign	Het
Hmcn2	G	A	2: 31,388,247	V1654M	probably damaging	Het
Htra3	G	T	5: 35,671,065	A157E	probably damaging	Het
Irs3	C	A	5: 137,643,877	R433L	probably benign	Het
Kcmf1	G	A	6: 72,848,241	Q239*	probably null	Het
Kcnk9	A	G	15: 72,513,056		probably benign	Het
Kif28	A	G	1: 179,702,526	V622A	probably benign	Het
Klrb1f	A	T	6: 129,054,331	I164F	probably benign	Het
Lama2	A	G	10: 27,190,625	S1087P	possibly damaging	Het
Mchr1	A	T	15: 81,235,747		probably benign	Het
Mcidas	A	G	13: 112,999,143	T367A	probably damaging	Het
Mphosph8	A	C	14: 56,674,413	K298Q	probably damaging	Het
Mroh2a	G	T	1: 88,235,216	Q360H	probably benign	Het
Mst1	A	C	9: 108,083,594	D461A	probably benign	Het
Nckap1l	A	T	15: 103,464,652	S311C	probably benign	Het
Olfr1036	C	T	2: 86,075,091	A117V	probably benign	Het
Olfr1233	T	A	2: 89,340,078	M75L	probably benign	Het
Olfr1385	T	A	11: 49,494,767	V78E	probably damaging	Het
Olfr251	A	C	9: 38,378,794	K298N	probably damaging	Het
Pde3a	T	G	6: 141,498,684	C1073G	probably damaging	Het
Pkhd1	T	C	1: 20,117,788	D3432G	probably damaging	Het
Ppargc1b	G	T	18: 61,315,861	P130Q	probably damaging	Het
Ppp6r1	A	G	7: 4,642,214	I228T	probably damaging	Het
Pram1	A	G	17: 33,641,506	N349S	probably benign	Het
Ranbp6	C	T	19: 29,812,083	V290I	possibly damaging	Het
Rcan3	A	T	4: 135,416,603		probably null	Het
Scn8a	G	C	15: 101,008,306		probably benign	Het
Slc12a5	C	T	2: 164,994,062	T900M	probably benign	Het
Srsf10	A	G	4: 135,858,403	Y55C	probably damaging	Het
Syt7	G	T	19: 10,444,080	E450*	probably null	Het
Tbrg4	T	C	11: 6,623,832	K130R	probably benign	Het
Tgm7	C	A	2: 121,101,065	V206F	probably damaging	Het
Tmem131l	T	C	3: 84,031,648	D67G	probably damaging	Het
Ttc7	A	G	17: 87,330,044	K409R	probably benign	Het
Unc80	A	T	1: 66,550,937		probably benign	Het
Vmn1r171	C	T	7: 23,632,655	L102F	possibly damaging	Het
Vmn2r59	A	C	7: 42,046,492		probably benign	Het
Vsig2	A	G	9: 37,542,690	R191G	probably damaging	Het
Wdr86	T	A	5: 24,718,234	Q153H	probably benign	Het
Xxylt1	T	A	16: 31,007,798	N233I	probably damaging	Het
Zfp160	A	T	17: 21,026,877	E563V	probably damaging	Het
Zfp345	T	A	2: 150,473,403	E71D	probably benign	Het
Zfp541	A	G	7: 16,082,174	D862G	possibly damaging	Het
Zfp639	A	C	3: 32,517,110	Q47P	possibly damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	intron	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R7964:Igf2r	UTSW	17	12748704	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGCACCACGGAGTTAGATGTGTAAG -3'
(R):5'- TTCCCTGTTAGGTCAGCAAGGAGG -3'

Sequencing Primer
(F):5'- TCGCTGTCATCATGGAAGGAC -3'
(R):5'- TTAGGTCAGCAAGGAGGAGGAG -3'

Posted On

2013-05-09