Incidental Mutation 'R0412:Pram1'
ID36739
Institutional Source Beutler Lab
Gene Symbol Pram1
Ensembl Gene ENSMUSG00000032739
Gene NamePML-RAR alpha-regulated adaptor molecule 1
Synonyms
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0412 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33638056-33645706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33641506 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 349 (N349S)
Ref Sequence ENSEMBL: ENSMUSP00000057065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052079] [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000116619] [ENSMUST00000139302] [ENSMUST00000148178]
Predicted Effect probably benign
Transcript: ENSMUST00000052079
AA Change: N349S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057065
Gene: ENSMUSG00000032739
AA Change: N349S

DomainStartEndE-ValueType
internal_repeat_1 15 151 3.3e-6 PROSPERO
internal_repeat_1 237 378 3.3e-6 PROSPERO
low complexity region 393 404 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 480 486 N/A INTRINSIC
SH3 581 655 1.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087582
SMART Domains Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.7e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 2e-50 BLAST
low complexity region 590 603 N/A INTRINSIC
RRM 614 685 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114385
SMART Domains Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.5e-20 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 3.9e-5 PROSPERO
internal_repeat_2 479 581 3.9e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
internal_repeat_1 643 676 1.39e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000116619
Predicted Effect probably benign
Transcript: ENSMUST00000130946
SMART Domains Protein: ENSMUSP00000116671
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139302
SMART Domains Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.4e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 8e-51 BLAST
low complexity region 590 603 N/A INTRINSIC
internal_repeat_1 611 635 5.49e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000148178
SMART Domains Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.2e-22 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 6.64e-5 PROSPERO
internal_repeat_2 479 581 6.64e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
RRM 653 724 1.51e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166215
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to FYN binding protein (FYB/SLAP-130), an adaptor protein involved in T cell receptor mediated signaling. This gene is expressed and regulated during normal myelopoiesis. The expression of this gene is induced by retinoic acid and is inhibited by the expression of PML-RARalpha, a fusion protein of promyelocytic leukemia (PML) and the retinoic acid receptor-alpha (RARalpha). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have neutrophils that exhibit decreased adhesion-dependent reactive oxygen intermediate production and degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Pram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Pram1 APN 17 33642135 missense possibly damaging 0.79
IGL01949:Pram1 APN 17 33641335 missense probably damaging 0.99
IGL01983:Pram1 APN 17 33640861 missense probably damaging 0.98
IGL03403:Pram1 APN 17 33642143 missense probably damaging 0.99
R0100:Pram1 UTSW 17 33641399 missense possibly damaging 0.56
R1915:Pram1 UTSW 17 33641157 missense probably benign 0.34
R2216:Pram1 UTSW 17 33641284 missense probably benign 0.02
R4177:Pram1 UTSW 17 33641229 missense probably benign
R5007:Pram1 UTSW 17 33645437 missense probably damaging 1.00
R5077:Pram1 UTSW 17 33644904 nonsense probably null
R5381:Pram1 UTSW 17 33641626 missense probably damaging 1.00
R6063:Pram1 UTSW 17 33641412 nonsense probably null
R7815:Pram1 UTSW 17 33642132 missense probably benign 0.17
Z1177:Pram1 UTSW 17 33641599 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCCCATGTTCTATGAGTTCCC -3'
(R):5'- TGGAAGTCTTCTGATCTCCAGCGG -3'

Sequencing Primer
(F):5'- GTTCTATGAGTTCCCCCAGACAC -3'
(R):5'- GGTATCCCAGGGACTATAAGCC -3'
Posted On2013-05-09