Incidental Mutation 'R4770:Pde4dip'
ID367390
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 042410-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4770 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97767084 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 172 (A172D)
Ref Sequence ENSEMBL: ENSMUSP00000040905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045243] [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000175751]
Predicted Effect probably damaging
Transcript: ENSMUST00000045243
AA Change: A172D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040905
Gene: ENSMUSG00000038170
AA Change: A172D

DomainStartEndE-ValueType
low complexity region 72 90 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
SCOP:d1gw5a_ 613 839 3e-3 SMART
coiled coil region 909 985 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090750
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107038
SMART Domains Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
Pfam:Microtub_assoc 70 144 7.8e-32 PFAM
low complexity region 150 165 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
internal_repeat_1 343 384 5.54e-5 PROSPERO
low complexity region 513 524 N/A INTRINSIC
internal_repeat_1 566 607 5.54e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168438
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175751
AA Change: A172D

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134832
Gene: ENSMUSG00000038170
AA Change: A172D

DomainStartEndE-ValueType
Pfam:zf-AD 4 78 4.3e-8 PFAM
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
coiled coil region 513 538 N/A INTRINSIC
Meta Mutation Damage Score 0.5243 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 93% (89/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,071,515 V503A possibly damaging Het
Agps T A 2: 75,891,855 F463Y possibly damaging Het
Amigo3 A T 9: 108,053,535 L52F probably damaging Het
Anapc1 T C 2: 128,686,060 probably benign Het
Ankrd36 G T 11: 5,590,870 C312F possibly damaging Het
Asic2 A C 11: 80,971,492 D226E probably benign Het
Atp8b2 T A 3: 89,957,067 Q197L probably damaging Het
C2cd3 A G 7: 100,443,435 Y495C probably damaging Het
Ccdc51 A G 9: 109,090,910 T125A probably benign Het
Ccser1 A G 6: 61,311,501 Y216C possibly damaging Het
Cntfr A T 4: 41,663,282 I175N possibly damaging Het
Cox10 G A 11: 63,964,163 R431W probably benign Het
Cubn T C 2: 13,314,767 T2881A possibly damaging Het
Cyp2d9 T A 15: 82,452,573 V41E probably damaging Het
Dmrtb1 C T 4: 107,683,789 G125D probably benign Het
Dscaml1 C T 9: 45,670,106 R408C probably damaging Het
Duox2 A T 2: 122,284,916 S1052T probably benign Het
Ecm1 A G 3: 95,737,961 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Epb41l1 T A 2: 156,529,424 M727K probably benign Het
Exosc9 T C 3: 36,553,835 V64A probably damaging Het
Ezh2 A T 6: 47,540,696 I564N probably damaging Het
Fam160b2 T A 14: 70,588,287 D351V probably damaging Het
Fam89b C A 19: 5,729,454 R25L probably damaging Het
Fgr C T 4: 132,987,291 T98M probably damaging Het
Gapvd1 A G 2: 34,691,181 S1089P probably damaging Het
Gbp5 A T 3: 142,508,076 I544F possibly damaging Het
Gli2 C A 1: 118,982,588 probably benign Het
Gm13084 C T 4: 143,811,949 E151K probably damaging Het
Gm9934 A G 7: 93,052,984 noncoding transcript Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Greb1 A T 12: 16,681,356 D1660E probably benign Het
Gtf2i T A 5: 134,243,560 N750I possibly damaging Het
H2-DMb2 G C 17: 34,148,724 D171H probably damaging Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Itga2b A G 11: 102,460,756 F581S probably damaging Het
Itsn2 T A 12: 4,627,892 M83K probably damaging Het
Kif27 G A 13: 58,344,377 T316M probably damaging Het
Lad1 A T 1: 135,825,793 Q26L probably damaging Het
Lrrn3 T A 12: 41,452,443 H625L probably benign Het
Mast1 A G 8: 84,929,246 V155A probably benign Het
Mast3 G A 8: 70,786,220 T480M probably damaging Het
Mpc1 C T 17: 8,293,545 probably benign Het
Mycbp2 T A 14: 103,219,944 M1606L probably benign Het
Myo1c T A 11: 75,660,313 L238* probably null Het
Nanog T G 6: 122,711,591 S44A possibly damaging Het
Neb T C 2: 52,149,153 Q6958R probably benign Het
Ngef C T 1: 87,477,561 R709H probably damaging Het
Nr1d1 A G 11: 98,770,645 V265A probably benign Het
Nr3c2 A G 8: 76,908,243 probably null Het
Odf3b A G 15: 89,379,123 I19T probably damaging Het
Olfm5 A G 7: 104,160,478 S164P probably benign Het
Parvb T C 15: 84,303,905 probably null Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Pik3r6 T A 11: 68,529,894 V155E probably damaging Het
Pinx1 T G 14: 63,872,371 V124G probably damaging Het
Poglut1 A G 16: 38,534,757 Y236H probably damaging Het
Pou4f2 T A 8: 78,436,401 M2L unknown Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkaca A G 8: 83,990,870 N209S probably benign Het
Ring1 G A 17: 34,023,387 P49S probably damaging Het
Rnf20 T A 4: 49,633,412 probably null Het
Rnf25 G A 1: 74,593,940 R418C probably damaging Het
Ryr1 G T 7: 29,109,282 P462Q probably damaging Het
Serpinb3d A G 1: 107,078,278 F360S probably damaging Het
Setd7 T C 3: 51,521,422 E329G probably damaging Het
Slco2b1 C T 7: 99,670,949 probably null Het
Snap91 G A 9: 86,773,601 T844I possibly damaging Het
Snhg5 C T 9: 88,522,371 noncoding transcript Het
Son T A 16: 91,658,868 V1501E probably damaging Het
Syncrip T A 9: 88,479,852 E70V probably damaging Het
Tas2r125 A G 6: 132,909,787 D46G probably damaging Het
Tmem115 G A 9: 107,534,957 R160Q probably benign Het
Trerf1 G A 17: 47,319,655 noncoding transcript Het
Uggt2 A T 14: 119,029,054 probably null Het
Ush2a G T 1: 188,549,879 V1864F probably benign Het
Xkr4 A T 1: 3,216,491 V492D probably damaging Het
Zcchc6 A G 13: 59,772,884 probably benign Het
Zfp646 T A 7: 127,883,477 S1609T possibly damaging Het
Zfp65 A T 13: 67,708,358 H277Q probably damaging Het
Zfp69 A G 4: 120,934,417 S176P probably damaging Het
Zfp747 C T 7: 127,375,799 A10T probably damaging Het
Zfp850 T C 7: 27,984,986 probably null Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGACACTAGCATCCAGAGAC -3'
(R):5'- GTAGACATTTCCGGCTTGCC -3'

Sequencing Primer
(F):5'- AGGAACCTGGTGTCCCTTC -3'
(R):5'- CTTGCCAGATATGAGGTACGC -3'
Posted On2015-12-29