Incidental Mutation 'R4770:Rnf20'
ID 367394
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
MMRRC Submission 042410-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4770 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 49633412 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000140341] [ENSMUST00000140341] [ENSMUST00000146547] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect probably null
Transcript: ENSMUST00000029989
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132782
Predicted Effect probably null
Transcript: ENSMUST00000140341
SMART Domains Protein: ENSMUSP00000121334
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140341
SMART Domains Protein: ENSMUSP00000121334
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146547
SMART Domains Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146547
SMART Domains Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156314
SMART Domains Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
SCOP:d1gw5a_ 174 294 3e-3 SMART
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167496
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 93% (89/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,071,515 V503A possibly damaging Het
Agps T A 2: 75,891,855 F463Y possibly damaging Het
Amigo3 A T 9: 108,053,535 L52F probably damaging Het
Anapc1 T C 2: 128,686,060 probably benign Het
Ankrd36 G T 11: 5,590,870 C312F possibly damaging Het
Asic2 A C 11: 80,971,492 D226E probably benign Het
Atp8b2 T A 3: 89,957,067 Q197L probably damaging Het
C2cd3 A G 7: 100,443,435 Y495C probably damaging Het
Ccdc51 A G 9: 109,090,910 T125A probably benign Het
Ccser1 A G 6: 61,311,501 Y216C possibly damaging Het
Cntfr A T 4: 41,663,282 I175N possibly damaging Het
Cox10 G A 11: 63,964,163 R431W probably benign Het
Cubn T C 2: 13,314,767 T2881A possibly damaging Het
Cyp2d9 T A 15: 82,452,573 V41E probably damaging Het
Dmrtb1 C T 4: 107,683,789 G125D probably benign Het
Dscaml1 C T 9: 45,670,106 R408C probably damaging Het
Duox2 A T 2: 122,284,916 S1052T probably benign Het
Ecm1 A G 3: 95,737,961 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Epb41l1 T A 2: 156,529,424 M727K probably benign Het
Exosc9 T C 3: 36,553,835 V64A probably damaging Het
Ezh2 A T 6: 47,540,696 I564N probably damaging Het
Fam160b2 T A 14: 70,588,287 D351V probably damaging Het
Fam89b C A 19: 5,729,454 R25L probably damaging Het
Fgr C T 4: 132,987,291 T98M probably damaging Het
Gapvd1 A G 2: 34,691,181 S1089P probably damaging Het
Gbp5 A T 3: 142,508,076 I544F possibly damaging Het
Gli2 C A 1: 118,982,588 probably benign Het
Gm13084 C T 4: 143,811,949 E151K probably damaging Het
Gm9934 A G 7: 93,052,984 noncoding transcript Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Greb1 A T 12: 16,681,356 D1660E probably benign Het
Gtf2i T A 5: 134,243,560 N750I possibly damaging Het
H2-DMb2 G C 17: 34,148,724 D171H probably damaging Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Itga2b A G 11: 102,460,756 F581S probably damaging Het
Itsn2 T A 12: 4,627,892 M83K probably damaging Het
Kif27 G A 13: 58,344,377 T316M probably damaging Het
Lad1 A T 1: 135,825,793 Q26L probably damaging Het
Lrrn3 T A 12: 41,452,443 H625L probably benign Het
Mast1 A G 8: 84,929,246 V155A probably benign Het
Mast3 G A 8: 70,786,220 T480M probably damaging Het
Mpc1 C T 17: 8,293,545 probably benign Het
Mycbp2 T A 14: 103,219,944 M1606L probably benign Het
Myo1c T A 11: 75,660,313 L238* probably null Het
Nanog T G 6: 122,711,591 S44A possibly damaging Het
Neb T C 2: 52,149,153 Q6958R probably benign Het
Ngef C T 1: 87,477,561 R709H probably damaging Het
Nr1d1 A G 11: 98,770,645 V265A probably benign Het
Nr3c2 A G 8: 76,908,243 probably null Het
Odf3b A G 15: 89,379,123 I19T probably damaging Het
Olfm5 A G 7: 104,160,478 S164P probably benign Het
Parvb T C 15: 84,303,905 probably null Het
Pde4dip G T 3: 97,767,084 A172D probably damaging Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Pik3r6 T A 11: 68,529,894 V155E probably damaging Het
Pinx1 T G 14: 63,872,371 V124G probably damaging Het
Poglut1 A G 16: 38,534,757 Y236H probably damaging Het
Pou4f2 T A 8: 78,436,401 M2L unknown Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkaca A G 8: 83,990,870 N209S probably benign Het
Ring1 G A 17: 34,023,387 P49S probably damaging Het
Rnf25 G A 1: 74,593,940 R418C probably damaging Het
Ryr1 G T 7: 29,109,282 P462Q probably damaging Het
Serpinb3d A G 1: 107,078,278 F360S probably damaging Het
Setd7 T C 3: 51,521,422 E329G probably damaging Het
Slco2b1 C T 7: 99,670,949 probably null Het
Snap91 G A 9: 86,773,601 T844I possibly damaging Het
Snhg5 C T 9: 88,522,371 noncoding transcript Het
Son T A 16: 91,658,868 V1501E probably damaging Het
Syncrip T A 9: 88,479,852 E70V probably damaging Het
Tas2r125 A G 6: 132,909,787 D46G probably damaging Het
Tmem115 G A 9: 107,534,957 R160Q probably benign Het
Trerf1 G A 17: 47,319,655 noncoding transcript Het
Uggt2 A T 14: 119,029,054 probably null Het
Ush2a G T 1: 188,549,879 V1864F probably benign Het
Xkr4 A T 1: 3,216,491 V492D probably damaging Het
Zcchc6 A G 13: 59,772,884 probably benign Het
Zfp646 T A 7: 127,883,477 S1609T possibly damaging Het
Zfp65 A T 13: 67,708,358 H277Q probably damaging Het
Zfp69 A G 4: 120,934,417 S176P probably damaging Het
Zfp747 C T 7: 127,375,799 A10T probably damaging Het
Zfp850 T C 7: 27,984,986 probably null Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4726:Rnf20 UTSW 4 49654579 nonsense probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5379:Rnf20 UTSW 4 49652639 missense possibly damaging 0.47
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R6608:Rnf20 UTSW 4 49650051 missense probably benign 0.05
R7064:Rnf20 UTSW 4 49644580 nonsense probably null
R7776:Rnf20 UTSW 4 49644592 nonsense probably null
R8735:Rnf20 UTSW 4 49655964 missense possibly damaging 0.95
R8995:Rnf20 UTSW 4 49648437 missense possibly damaging 0.94
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCAATCCCATTCCTCAACAG -3'
(R):5'- TAGGGTGCCTCTCAGAACAC -3'

Sequencing Primer
(F):5'- ACAGGTACTTTATATTGTGGCATGTC -3'
(R):5'- CACGGCACCTATTTTTCAGTAAGGG -3'
Posted On 2015-12-29