Mutagenetix > Incidental Mutation

Incidental Mutation 'R4770:Ezh2'

367399

Institutional Source

Beutler Lab

Gene Symbol

Ezh2

Ensembl Gene

ENSMUSG00000029687

Gene Name

enhancer of zeste 2 polycomb repressive complex 2 subunit

Synonyms

Enx-1, KMT6, Enx1h

MMRRC Submission

042410-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47530139-47595341 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47540696 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 564 (I564N)

Ref Sequence

ENSEMBL: ENSMUSP00000090318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618]

AlphaFold

Q61188

Predicted Effect

probably damaging
Transcript: ENSMUST00000081721
AA Change: I606N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: I606N

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	6.1e-18	PFAM
SANT	159	250	9.7e-3	SMART
low complexity region	349	366	N/A	INTRINSIC
low complexity region	385	409	N/A	INTRINSIC
SANT	428	476	6.62e-1	SMART
CXC	555	592	1.05e-1	SMART
SET	612	733	4.15e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000092648
AA Change: I564N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687
AA Change: I564N

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	6.9e-20	PFAM
SANT	159	250	9.7e-3	SMART
Blast:SET	272	333	3e-13	BLAST
low complexity region	349	366	N/A	INTRINSIC
low complexity region	385	409	N/A	INTRINSIC
SANT	428	476	6.62e-1	SMART
CXC	513	550	1.05e-1	SMART
SET	570	691	4.15e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114616
AA Change: I567N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: I567N

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	2.5e-20	PFAM
SANT	120	211	9.7e-3	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	346	370	N/A	INTRINSIC
SANT	389	437	6.62e-1	SMART
CXC	516	553	1.05e-1	SMART
SET	573	694	4.15e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114618
AA Change: I602N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: I602N

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	7.4e-20	PFAM
SANT	150	241	9.7e-3	SMART
low complexity region	345	362	N/A	INTRINSIC
low complexity region	381	405	N/A	INTRINSIC
SANT	424	472	6.62e-1	SMART
CXC	551	588	1.05e-1	SMART
SET	608	729	4.15e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164006

SMART Domains

Protein: ENSMUSP00000133195
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
Blast:SET	2	96	1e-16	BLAST
low complexity region	98	122	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165492

Predicted Effect

probably benign
Transcript: ENSMUST00000167278

SMART Domains

Protein: ENSMUSP00000128542
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
Blast:SET	2	43	6e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170311

Predicted Effect

unknown
Transcript: ENSMUST00000204243
AA Change: I13N

Meta Mutation Damage Score

0.9380

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

93% (89/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	G	11: 110,071,515	V503A	possibly damaging	Het
Agps	T	A	2: 75,891,855	F463Y	possibly damaging	Het
Amigo3	A	T	9: 108,053,535	L52F	probably damaging	Het
Anapc1	T	C	2: 128,686,060		probably benign	Het
Ankrd36	G	T	11: 5,590,870	C312F	possibly damaging	Het
Asic2	A	C	11: 80,971,492	D226E	probably benign	Het
Atp8b2	T	A	3: 89,957,067	Q197L	probably damaging	Het
C2cd3	A	G	7: 100,443,435	Y495C	probably damaging	Het
Ccdc51	A	G	9: 109,090,910	T125A	probably benign	Het
Ccser1	A	G	6: 61,311,501	Y216C	possibly damaging	Het
Cntfr	A	T	4: 41,663,282	I175N	possibly damaging	Het
Cox10	G	A	11: 63,964,163	R431W	probably benign	Het
Cubn	T	C	2: 13,314,767	T2881A	possibly damaging	Het
Cyp2d9	T	A	15: 82,452,573	V41E	probably damaging	Het
Dmrtb1	C	T	4: 107,683,789	G125D	probably benign	Het
Dscaml1	C	T	9: 45,670,106	R408C	probably damaging	Het
Duox2	A	T	2: 122,284,916	S1052T	probably benign	Het
Ecm1	A	G	3: 95,737,961		probably benign	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Epb41l1	T	A	2: 156,529,424	M727K	probably benign	Het
Exosc9	T	C	3: 36,553,835	V64A	probably damaging	Het
Fam160b2	T	A	14: 70,588,287	D351V	probably damaging	Het
Fam89b	C	A	19: 5,729,454	R25L	probably damaging	Het
Fgr	C	T	4: 132,987,291	T98M	probably damaging	Het
Gapvd1	A	G	2: 34,691,181	S1089P	probably damaging	Het
Gbp5	A	T	3: 142,508,076	I544F	possibly damaging	Het
Gli2	C	A	1: 118,982,588		probably benign	Het
Gm13084	C	T	4: 143,811,949	E151K	probably damaging	Het
Gm9934	A	G	7: 93,052,984		noncoding transcript	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Greb1	A	T	12: 16,681,356	D1660E	probably benign	Het
Gtf2i	T	A	5: 134,243,560	N750I	possibly damaging	Het
H2-DMb2	G	C	17: 34,148,724	D171H	probably damaging	Het
Il11ra1	A	G	4: 41,768,187	E366G	probably damaging	Het
Itga2b	A	G	11: 102,460,756	F581S	probably damaging	Het
Itsn2	T	A	12: 4,627,892	M83K	probably damaging	Het
Kif27	G	A	13: 58,344,377	T316M	probably damaging	Het
Lad1	A	T	1: 135,825,793	Q26L	probably damaging	Het
Lrrn3	T	A	12: 41,452,443	H625L	probably benign	Het
Mast1	A	G	8: 84,929,246	V155A	probably benign	Het
Mast3	G	A	8: 70,786,220	T480M	probably damaging	Het
Mpc1	C	T	17: 8,293,545		probably benign	Het
Mycbp2	T	A	14: 103,219,944	M1606L	probably benign	Het
Myo1c	T	A	11: 75,660,313	L238*	probably null	Het
Nanog	T	G	6: 122,711,591	S44A	possibly damaging	Het
Neb	T	C	2: 52,149,153	Q6958R	probably benign	Het
Ngef	C	T	1: 87,477,561	R709H	probably damaging	Het
Nr1d1	A	G	11: 98,770,645	V265A	probably benign	Het
Nr3c2	A	G	8: 76,908,243		probably null	Het
Odf3b	A	G	15: 89,379,123	I19T	probably damaging	Het
Olfm5	A	G	7: 104,160,478	S164P	probably benign	Het
Parvb	T	C	15: 84,303,905		probably null	Het
Pde4dip	G	T	3: 97,767,084	A172D	probably damaging	Het
Phf2	A	G	13: 48,803,603	L1096P	probably damaging	Het
Pik3r6	T	A	11: 68,529,894	V155E	probably damaging	Het
Pinx1	T	G	14: 63,872,371	V124G	probably damaging	Het
Poglut1	A	G	16: 38,534,757	Y236H	probably damaging	Het
Pou4f2	T	A	8: 78,436,401	M2L	unknown	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prkaca	A	G	8: 83,990,870	N209S	probably benign	Het
Ring1	G	A	17: 34,023,387	P49S	probably damaging	Het
Rnf20	T	A	4: 49,633,412		probably null	Het
Rnf25	G	A	1: 74,593,940	R418C	probably damaging	Het
Ryr1	G	T	7: 29,109,282	P462Q	probably damaging	Het
Serpinb3d	A	G	1: 107,078,278	F360S	probably damaging	Het
Setd7	T	C	3: 51,521,422	E329G	probably damaging	Het
Slco2b1	C	T	7: 99,670,949		probably null	Het
Snap91	G	A	9: 86,773,601	T844I	possibly damaging	Het
Snhg5	C	T	9: 88,522,371		noncoding transcript	Het
Son	T	A	16: 91,658,868	V1501E	probably damaging	Het
Syncrip	T	A	9: 88,479,852	E70V	probably damaging	Het
Tas2r125	A	G	6: 132,909,787	D46G	probably damaging	Het
Tmem115	G	A	9: 107,534,957	R160Q	probably benign	Het
Trerf1	G	A	17: 47,319,655		noncoding transcript	Het
Uggt2	A	T	14: 119,029,054		probably null	Het
Ush2a	G	T	1: 188,549,879	V1864F	probably benign	Het
Xkr4	A	T	1: 3,216,491	V492D	probably damaging	Het
Zcchc6	A	G	13: 59,772,884		probably benign	Het
Zfp646	T	A	7: 127,883,477	S1609T	possibly damaging	Het
Zfp65	A	T	13: 67,708,358	H277Q	probably damaging	Het
Zfp69	A	G	4: 120,934,417	S176P	probably damaging	Het
Zfp747	C	T	7: 127,375,799	A10T	probably damaging	Het
Zfp850	T	C	7: 27,984,986		probably null	Het

Other mutations in Ezh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01582:Ezh2	APN	6	47556055	nonsense	probably null
IGL01932:Ezh2	APN	6	47532048	missense	probably damaging	0.99
IGL02019:Ezh2	APN	6	47551901	splice site	probably null
IGL02748:Ezh2	APN	6	47558239	missense	probably damaging	1.00
IGL02749:Ezh2	APN	6	47533764	missense	probably damaging	0.99
IGL03171:Ezh2	APN	6	47540781	nonsense	probably null
Peezy	UTSW	6	47533758	nonsense	probably null
R0417:Ezh2	UTSW	6	47551726	missense	probably benign	0.00
R1256:Ezh2	UTSW	6	47541855	nonsense	probably null
R1587:Ezh2	UTSW	6	47552490	critical splice acceptor site	probably null
R1631:Ezh2	UTSW	6	47577658	start codon destroyed	probably null	0.01
R1736:Ezh2	UTSW	6	47576660	missense	probably damaging	1.00
R1775:Ezh2	UTSW	6	47576660	missense	probably damaging	1.00
R2076:Ezh2	UTSW	6	47576633	nonsense	probably null
R2311:Ezh2	UTSW	6	47558260	missense	probably damaging	1.00
R3751:Ezh2	UTSW	6	47556064	missense	possibly damaging	0.94
R4016:Ezh2	UTSW	6	47544582	missense	probably benign
R4119:Ezh2	UTSW	6	47544548	missense	probably benign	0.00
R4214:Ezh2	UTSW	6	47533814	missense	probably damaging	1.00
R5133:Ezh2	UTSW	6	47540750	missense	probably damaging	1.00
R5137:Ezh2	UTSW	6	47532080	splice site	probably null
R5199:Ezh2	UTSW	6	47551725	missense	probably benign	0.01
R5343:Ezh2	UTSW	6	47576615	missense	probably damaging	1.00
R5584:Ezh2	UTSW	6	47532016	missense	probably damaging	1.00
R5942:Ezh2	UTSW	6	47577582	missense	possibly damaging	0.94
R6057:Ezh2	UTSW	6	47552423	missense	probably damaging	1.00
R7247:Ezh2	UTSW	6	47533774	missense	probably damaging	1.00
R7284:Ezh2	UTSW	6	47544519	missense	probably benign	0.00
R7365:Ezh2	UTSW	6	47533758	nonsense	probably null
R7382:Ezh2	UTSW	6	47551836	missense	possibly damaging	0.55
R7718:Ezh2	UTSW	6	47554191	missense	probably benign
R7910:Ezh2	UTSW	6	47556143	missense	probably damaging	0.96
R8206:Ezh2	UTSW	6	47532900	critical splice donor site	probably null
R8428:Ezh2	UTSW	6	47545811	nonsense	probably null
R8746:Ezh2	UTSW	6	47576600	missense	probably damaging	0.99
R8836:Ezh2	UTSW	6	47554262	missense	probably benign
R8925:Ezh2	UTSW	6	47533779	missense	possibly damaging	0.89
R8927:Ezh2	UTSW	6	47533779	missense	possibly damaging	0.89
R9039:Ezh2	UTSW	6	47551737	missense	possibly damaging	0.80
R9171:Ezh2	UTSW	6	47554200	missense	probably benign
X0021:Ezh2	UTSW	6	47554169	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCATCACGCACATTTAAGAGTCAC -3'
(R):5'- TGCCTTCCTGGAAAGGATGTG -3'

Sequencing Primer
(F):5'- AAGCCCTGGGTTTACTCCACAG -3'
(R):5'- ATGGTGGTGATGATACATTTATCCC -3'

Posted On

2015-12-29