Incidental Mutation 'R0412:H2-Bl'
ID36740
Institutional Source Beutler Lab
Gene Symbol H2-Bl
Ensembl Gene ENSMUSG00000073406
Gene Namehistocompatibility 2, blastocyst
Synonymsblastocyst MHC
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0412 (G1)
Quality Score172
Status Validated
Chromosome17
Chromosomal Location36080115-36084223 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 36081521 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173080] [ENSMUST00000183560] [ENSMUST00000183999] [ENSMUST00000184502] [ENSMUST00000185087] [ENSMUST00000185167] [ENSMUST00000192532] [ENSMUST00000194244] [ENSMUST00000195833] [ENSMUST00000195838]
Predicted Effect probably benign
Transcript: ENSMUST00000173080
SMART Domains Protein: ENSMUSP00000134155
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.6e-88 PFAM
IGc1 219 289 6.29e-19 SMART
transmembrane domain 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173674
SMART Domains Protein: ENSMUSP00000134330
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
SCOP:d1dr9a2 21 36 4e-5 SMART
transmembrane domain 46 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183560
SMART Domains Protein: ENSMUSP00000138812
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183999
SMART Domains Protein: ENSMUSP00000139165
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
SCOP:d1dr9a2 21 36 4e-5 SMART
transmembrane domain 46 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184502
SMART Domains Protein: ENSMUSP00000139275
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.8e-89 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184850
Predicted Effect probably benign
Transcript: ENSMUST00000185087
SMART Domains Protein: ENSMUSP00000139166
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 113 5.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185167
SMART Domains Protein: ENSMUSP00000139373
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192532
SMART Domains Protein: ENSMUSP00000142113
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
Pfam:MHC_I 12 190 1.4e-88 PFAM
IGc1 209 279 6.29e-19 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194244
SMART Domains Protein: ENSMUSP00000141809
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 118 2.9e-43 PFAM
IGc1 127 197 6.29e-19 SMART
transmembrane domain 213 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195833
SMART Domains Protein: ENSMUSP00000141271
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
Pfam:MHC_I 12 107 1.8e-37 PFAM
IGc1 116 186 6.29e-19 SMART
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195838
SMART Domains Protein: ENSMUSP00000141253
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
Pfam:MHC_I 12 189 1e-82 PFAM
IGc1 208 278 6.29e-19 SMART
transmembrane domain 294 316 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in H2-Bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0396:H2-Bl UTSW 17 36083722 missense possibly damaging 0.47
R0924:H2-Bl UTSW 17 36083932 missense probably damaging 1.00
R1170:H2-Bl UTSW 17 36081091 missense possibly damaging 0.66
R1211:H2-Bl UTSW 17 36081073 missense probably damaging 1.00
R1902:H2-Bl UTSW 17 36083953 missense probably damaging 1.00
R1913:H2-Bl UTSW 17 36081016 missense probably damaging 0.99
R1992:H2-Bl UTSW 17 36081046 missense probably damaging 0.98
R5538:H2-Bl UTSW 17 36081286 missense probably benign 0.35
R6021:H2-Bl UTSW 17 36081274 missense probably damaging 1.00
R7091:H2-Bl UTSW 17 36083941 missense possibly damaging 0.94
R7200:H2-Bl UTSW 17 36081046 missense possibly damaging 0.83
R7711:H2-Bl UTSW 17 36083878 missense probably damaging 0.98
R8479:H2-Bl UTSW 17 36084219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCTCCTTCCCAAGAGGCAC -3'
(R):5'- ATGACCATGTTGACCCACTGGCTC -3'

Sequencing Primer
(F):5'- TAGAAGGTTCCATCCCCTGC -3'
(R):5'- atgtaagtacattgtagctgtcttc -3'
Posted On2013-05-09