Mutagenetix > Incidental Mutations

Incidental Mutation 'R0412:Arhgap28'

36741

Institutional Source

Beutler Lab

Gene Symbol

Arhgap28

Ensembl Gene

ENSMUSG00000024043

Gene Name

Rho GTPase activating protein 28

Synonyms

MMRRC Submission

038614-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0412 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

67842713-68004120 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 67896258 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 67 (L67F)

Ref Sequence

ENSEMBL: ENSMUSP00000128194 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024840
AA Change: L117F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: L117F

Domain	Start	End	E-Value	Type
low complexity region	63	76	N/A	INTRINSIC
RhoGAP	400	578	1.41e-34	SMART
Blast:RhoGAP	583	612	2e-7	BLAST
Blast:RhoGAP	640	681	9e-6	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000163865
AA Change: L67F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: L67F

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
RhoGAP	350	527	7.1e-31	SMART
Blast:RhoGAP	532	561	1e-7	BLAST
Blast:RhoGAP	589	630	8e-6	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000164647
AA Change: L67F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: L67F

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
RhoGAP	350	528	1.41e-34	SMART
Blast:RhoGAP	533	562	1e-7	BLAST
Blast:RhoGAP	590	631	8e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000170581

SMART Domains

Protein: ENSMUSP00000131903
Gene: ENSMUSG00000024043

Domain	Start	End	E-Value	Type
Blast:RhoGAP	151	213	1e-33	BLAST
SCOP:d1tx4a_	182	235	1e-10	SMART

Meta Mutation Damage Score

0.1855

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.2%

Validation Efficiency

94% (67/71)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	C	G	7: 29,530,570		noncoding transcript	Het
Arap1	C	A	7: 101,390,222	A563D	probably damaging	Het
Atp7b	G	T	8: 21,995,659		probably null	Het
Auts2	A	G	5: 131,446,831	F485L	probably benign	Het
Ccdc68	A	G	18: 69,960,439	E239G	probably damaging	Het
Cdc42bpg	T	G	19: 6,313,457	L449R	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Ddx41	G	T	13: 55,530,608	S630Y	probably damaging	Het
Dntt	T	C	19: 41,042,933	L274P	probably damaging	Het
Fhl4	G	T	10: 85,098,816	H34N	possibly damaging	Het
Filip1	A	T	9: 79,820,289	N349K	possibly damaging	Het
Gm9894	C	T	13: 67,765,026		noncoding transcript	Het
Gpr179	A	G	11: 97,338,807	S841P	probably damaging	Het
Gpr35	G	T	1: 92,982,784	V73L	probably benign	Het
Grik5	A	G	7: 25,013,674	V809A	possibly damaging	Het
H2-Bl	T	A	17: 36,081,521		probably benign	Het
Heatr5b	T	C	17: 78,820,854	T451A	probably benign	Het
Hmcn2	G	A	2: 31,388,247	V1654M	probably damaging	Het
Htra3	G	T	5: 35,671,065	A157E	probably damaging	Het
Igf2r	A	T	17: 12,683,948	V2405D	probably damaging	Het
Irs3	C	A	5: 137,643,877	R433L	probably benign	Het
Kcmf1	G	A	6: 72,848,241	Q239*	probably null	Het
Kcnk9	A	G	15: 72,513,056		probably benign	Het
Kif28	A	G	1: 179,702,526	V622A	probably benign	Het
Klrb1f	A	T	6: 129,054,331	I164F	probably benign	Het
Lama2	A	G	10: 27,190,625	S1087P	possibly damaging	Het
Mchr1	A	T	15: 81,235,747		probably benign	Het
Mcidas	A	G	13: 112,999,143	T367A	probably damaging	Het
Mphosph8	A	C	14: 56,674,413	K298Q	probably damaging	Het
Mroh2a	G	T	1: 88,235,216	Q360H	probably benign	Het
Mst1	A	C	9: 108,083,594	D461A	probably benign	Het
Nckap1l	A	T	15: 103,464,652	S311C	probably benign	Het
Olfr1036	C	T	2: 86,075,091	A117V	probably benign	Het
Olfr1233	T	A	2: 89,340,078	M75L	probably benign	Het
Olfr1385	T	A	11: 49,494,767	V78E	probably damaging	Het
Olfr251	A	C	9: 38,378,794	K298N	probably damaging	Het
Pde3a	T	G	6: 141,498,684	C1073G	probably damaging	Het
Pkhd1	T	C	1: 20,117,788	D3432G	probably damaging	Het
Ppargc1b	G	T	18: 61,315,861	P130Q	probably damaging	Het
Ppp6r1	A	G	7: 4,642,214	I228T	probably damaging	Het
Pram1	A	G	17: 33,641,506	N349S	probably benign	Het
Ranbp6	C	T	19: 29,812,083	V290I	possibly damaging	Het
Rcan3	A	T	4: 135,416,603		probably null	Het
Scn8a	G	C	15: 101,008,306		probably benign	Het
Slc12a5	C	T	2: 164,994,062	T900M	probably benign	Het
Srsf10	A	G	4: 135,858,403	Y55C	probably damaging	Het
Syt7	G	T	19: 10,444,080	E450*	probably null	Het
Tbrg4	T	C	11: 6,623,832	K130R	probably benign	Het
Tgm7	C	A	2: 121,101,065	V206F	probably damaging	Het
Tmem131l	T	C	3: 84,031,648	D67G	probably damaging	Het
Ttc7	A	G	17: 87,330,044	K409R	probably benign	Het
Unc80	A	T	1: 66,550,937		probably benign	Het
Vmn1r171	C	T	7: 23,632,655	L102F	possibly damaging	Het
Vmn2r59	A	C	7: 42,046,492		probably benign	Het
Vsig2	A	G	9: 37,542,690	R191G	probably damaging	Het
Wdr86	T	A	5: 24,718,234	Q153H	probably benign	Het
Xxylt1	T	A	16: 31,007,798	N233I	probably damaging	Het
Zfp160	A	T	17: 21,026,877	E563V	probably damaging	Het
Zfp345	T	A	2: 150,473,403	E71D	probably benign	Het
Zfp541	A	G	7: 16,082,174	D862G	possibly damaging	Het
Zfp639	A	C	3: 32,517,110	Q47P	possibly damaging	Het

Other mutations in Arhgap28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Arhgap28	APN	17	67845801	missense	probably damaging	1.00
IGL01388:Arhgap28	APN	17	67853039	unclassified	probably benign
IGL01560:Arhgap28	APN	17	67896071	missense	probably damaging	1.00
IGL01578:Arhgap28	APN	17	67858200	missense	probably benign	0.00
IGL01650:Arhgap28	APN	17	67873132	missense	probably damaging	0.97
IGL02383:Arhgap28	APN	17	67896089	missense	probably benign	0.00
IGL02403:Arhgap28	APN	17	67873159	missense	possibly damaging	0.87
IGL02652:Arhgap28	APN	17	67884800	missense	probably benign	0.00
IGL03102:Arhgap28	APN	17	67896236	missense	probably damaging	1.00
IGL03209:Arhgap28	APN	17	67868956	missense	probably damaging	1.00
IGL03306:Arhgap28	APN	17	67852935	missense	probably damaging	1.00
K3955:Arhgap28	UTSW	17	68004006	missense	probably damaging	0.98
PIT4445001:Arhgap28	UTSW	17	67896235	missense	possibly damaging	0.94
R0135:Arhgap28	UTSW	17	67864588	missense	probably damaging	1.00
R0309:Arhgap28	UTSW	17	67901429	missense	probably benign	0.13
R0385:Arhgap28	UTSW	17	67864606	missense	probably damaging	1.00
R0463:Arhgap28	UTSW	17	67896225	missense	probably damaging	1.00
R0626:Arhgap28	UTSW	17	67896113	splice site	probably null
R0691:Arhgap28	UTSW	17	67896164	splice site	probably null
R0811:Arhgap28	UTSW	17	67901299	small deletion	probably benign
R1150:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1151:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1152:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1426:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1427:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1632:Arhgap28	UTSW	17	67849074	missense	probably damaging	0.99
R1747:Arhgap28	UTSW	17	67901309	missense	probably benign	0.02
R1951:Arhgap28	UTSW	17	67901341	missense	probably benign	0.00
R2031:Arhgap28	UTSW	17	67896116	missense	probably damaging	1.00
R2126:Arhgap28	UTSW	17	67869015	missense	possibly damaging	0.90
R2181:Arhgap28	UTSW	17	67896117	missense	probably damaging	1.00
R3700:Arhgap28	UTSW	17	67901366	missense	probably damaging	1.00
R3800:Arhgap28	UTSW	17	67873036	missense	probably damaging	1.00
R3811:Arhgap28	UTSW	17	67896093	missense	probably benign
R4213:Arhgap28	UTSW	17	67871993	missense	probably benign	0.04
R4347:Arhgap28	UTSW	17	67873142	missense	probably benign
R4954:Arhgap28	UTSW	17	67869013	nonsense	probably null
R5592:Arhgap28	UTSW	17	67858272	missense	probably damaging	0.99
R5610:Arhgap28	UTSW	17	67896240	nonsense	probably null
R5758:Arhgap28	UTSW	17	67873159	missense	probably benign	0.04
R5774:Arhgap28	UTSW	17	67881492	missense	possibly damaging	0.94
R6413:Arhgap28	UTSW	17	67875588	missense	probably benign	0.00
R6661:Arhgap28	UTSW	17	67845751	missense	probably damaging	1.00
R7255:Arhgap28	UTSW	17	67853004	missense	probably damaging	0.99
R7324:Arhgap28	UTSW	17	67895884	splice site	probably null
R7338:Arhgap28	UTSW	17	67896111	missense	probably damaging	1.00
R7549:Arhgap28	UTSW	17	67871966	missense	probably damaging	1.00
R7860:Arhgap28	UTSW	17	67901282	nonsense	probably null
R8516:Arhgap28	UTSW	17	67873073	missense	probably benign	0.08
Z1088:Arhgap28	UTSW	17	67861277	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CATACAGGAGATTCGCTGACTCCG -3'
(R):5'- TCCTGGGCAGCCTTTTATGACTTTG -3'

Sequencing Primer
(F):5'- ATTCGCTGACTCCGAAGATG -3'
(R):5'- ttggaggtagaggcaggaag -3'

Posted On

2013-05-09