Incidental Mutation 'R4770:Zfp646'
ID367410
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Namezinc finger protein 646
Synonyms
MMRRC Submission 042410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4770 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127876221-127885996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127883477 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1609 (S1609T)
Ref Sequence ENSEMBL: ENSMUSP00000052641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000121394] [ENSMUST00000131000] [ENSMUST00000205300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050383
AA Change: S1609T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: S1609T

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121394
SMART Domains Protein: ENSMUSP00000112972
Gene: ENSMUSG00000044139

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 38 268 3.91e-45 SMART
Tryp_SPc 300 520 9.95e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126662
SMART Domains Protein: ENSMUSP00000123566
Gene: ENSMUSG00000030804

DomainStartEndE-ValueType
VKc 1 111 8.84e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131000
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205364
Predicted Effect unknown
Transcript: ENSMUST00000206340
AA Change: S1389T
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 93% (89/96)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,071,515 V503A possibly damaging Het
Agps T A 2: 75,891,855 F463Y possibly damaging Het
Amigo3 A T 9: 108,053,535 L52F probably damaging Het
Anapc1 T C 2: 128,686,060 probably benign Het
Ankrd36 G T 11: 5,590,870 C312F possibly damaging Het
Asic2 A C 11: 80,971,492 D226E probably benign Het
Atp8b2 T A 3: 89,957,067 Q197L probably damaging Het
C2cd3 A G 7: 100,443,435 Y495C probably damaging Het
Ccdc51 A G 9: 109,090,910 T125A probably benign Het
Ccser1 A G 6: 61,311,501 Y216C possibly damaging Het
Cntfr A T 4: 41,663,282 I175N possibly damaging Het
Cox10 G A 11: 63,964,163 R431W probably benign Het
Cubn T C 2: 13,314,767 T2881A possibly damaging Het
Cyp2d9 T A 15: 82,452,573 V41E probably damaging Het
Dmrtb1 C T 4: 107,683,789 G125D probably benign Het
Dscaml1 C T 9: 45,670,106 R408C probably damaging Het
Duox2 A T 2: 122,284,916 S1052T probably benign Het
Ecm1 A G 3: 95,737,961 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Epb41l1 T A 2: 156,529,424 M727K probably benign Het
Exosc9 T C 3: 36,553,835 V64A probably damaging Het
Ezh2 A T 6: 47,540,696 I564N probably damaging Het
Fam160b2 T A 14: 70,588,287 D351V probably damaging Het
Fam89b C A 19: 5,729,454 R25L probably damaging Het
Fgr C T 4: 132,987,291 T98M probably damaging Het
Gapvd1 A G 2: 34,691,181 S1089P probably damaging Het
Gbp5 A T 3: 142,508,076 I544F possibly damaging Het
Gli2 C A 1: 118,982,588 probably benign Het
Gm13084 C T 4: 143,811,949 E151K probably damaging Het
Gm9934 A G 7: 93,052,984 noncoding transcript Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Greb1 A T 12: 16,681,356 D1660E probably benign Het
Gtf2i T A 5: 134,243,560 N750I possibly damaging Het
H2-DMb2 G C 17: 34,148,724 D171H probably damaging Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Itga2b A G 11: 102,460,756 F581S probably damaging Het
Itsn2 T A 12: 4,627,892 M83K probably damaging Het
Kif27 G A 13: 58,344,377 T316M probably damaging Het
Lad1 A T 1: 135,825,793 Q26L probably damaging Het
Lrrn3 T A 12: 41,452,443 H625L probably benign Het
Mast1 A G 8: 84,929,246 V155A probably benign Het
Mast3 G A 8: 70,786,220 T480M probably damaging Het
Mpc1 C T 17: 8,293,545 probably benign Het
Mycbp2 T A 14: 103,219,944 M1606L probably benign Het
Myo1c T A 11: 75,660,313 L238* probably null Het
Nanog T G 6: 122,711,591 S44A possibly damaging Het
Neb T C 2: 52,149,153 Q6958R probably benign Het
Ngef C T 1: 87,477,561 R709H probably damaging Het
Nr1d1 A G 11: 98,770,645 V265A probably benign Het
Nr3c2 A G 8: 76,908,243 probably null Het
Odf3b A G 15: 89,379,123 I19T probably damaging Het
Olfm5 A G 7: 104,160,478 S164P probably benign Het
Parvb T C 15: 84,303,905 probably null Het
Pde4dip G T 3: 97,767,084 A172D probably damaging Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Pik3r6 T A 11: 68,529,894 V155E probably damaging Het
Pinx1 T G 14: 63,872,371 V124G probably damaging Het
Poglut1 A G 16: 38,534,757 Y236H probably damaging Het
Pou4f2 T A 8: 78,436,401 M2L unknown Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkaca A G 8: 83,990,870 N209S probably benign Het
Ring1 G A 17: 34,023,387 P49S probably damaging Het
Rnf20 T A 4: 49,633,412 probably null Het
Rnf25 G A 1: 74,593,940 R418C probably damaging Het
Ryr1 G T 7: 29,109,282 P462Q probably damaging Het
Serpinb3d A G 1: 107,078,278 F360S probably damaging Het
Setd7 T C 3: 51,521,422 E329G probably damaging Het
Slco2b1 C T 7: 99,670,949 probably null Het
Snap91 G A 9: 86,773,601 T844I possibly damaging Het
Snhg5 C T 9: 88,522,371 noncoding transcript Het
Son T A 16: 91,658,868 V1501E probably damaging Het
Syncrip T A 9: 88,479,852 E70V probably damaging Het
Tas2r125 A G 6: 132,909,787 D46G probably damaging Het
Tmem115 G A 9: 107,534,957 R160Q probably benign Het
Trerf1 G A 17: 47,319,655 noncoding transcript Het
Uggt2 A T 14: 119,029,054 probably null Het
Ush2a G T 1: 188,549,879 V1864F probably benign Het
Xkr4 A T 1: 3,216,491 V492D probably damaging Het
Zcchc6 A G 13: 59,772,884 probably benign Het
Zfp65 A T 13: 67,708,358 H277Q probably damaging Het
Zfp69 A G 4: 120,934,417 S176P probably damaging Het
Zfp747 C T 7: 127,375,799 A10T probably damaging Het
Zfp850 T C 7: 27,984,986 probably null Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127879130 missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127878965 missense probably benign
IGL02571:Zfp646 APN 7 127879412 missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127880731 missense probably damaging 0.96
R0084:Zfp646 UTSW 7 127881304 missense possibly damaging 0.86
R0140:Zfp646 UTSW 7 127883506 missense probably benign 0.41
R0394:Zfp646 UTSW 7 127883262 missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127881966 missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127883810 nonsense probably null
R0930:Zfp646 UTSW 7 127883810 nonsense probably null
R1219:Zfp646 UTSW 7 127883120 missense probably benign
R1221:Zfp646 UTSW 7 127883120 missense probably benign
R1351:Zfp646 UTSW 7 127883511 missense probably benign
R1370:Zfp646 UTSW 7 127879864 missense probably damaging 1.00
R1503:Zfp646 UTSW 7 127880136 missense probably damaging 1.00
R1605:Zfp646 UTSW 7 127880187 splice site probably null
R1817:Zfp646 UTSW 7 127883120 missense probably benign
R1818:Zfp646 UTSW 7 127883120 missense probably benign
R1819:Zfp646 UTSW 7 127883120 missense probably benign
R1838:Zfp646 UTSW 7 127879739 missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127883849 missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127882187 missense probably damaging 1.00
R2763:Zfp646 UTSW 7 127880038 nonsense probably null
R4346:Zfp646 UTSW 7 127879509 missense probably damaging 1.00
R4824:Zfp646 UTSW 7 127883735 missense probably benign 0.00
R4936:Zfp646 UTSW 7 127881761 missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127879182 missense probably benign 0.01
R5062:Zfp646 UTSW 7 127880499 missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127882703 missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127879358 missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127885454 missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127879018 missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127878725 missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127883907 missense probably benign 0.13
R6331:Zfp646 UTSW 7 127883681 missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127879941 missense probably benign 0.00
R6814:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6872:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6903:Zfp646 UTSW 7 127880720 missense possibly damaging 0.91
R7018:Zfp646 UTSW 7 127882322 missense probably benign
R7049:Zfp646 UTSW 7 127880027 missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127879772 missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127878796 nonsense probably null
R8345:Zfp646 UTSW 7 127883910 missense probably benign 0.12
Z1177:Zfp646 UTSW 7 127880632 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTGAATCCTGTGACCACTGAGATC -3'
(R):5'- TAGAGTCCAATGGTGTGGGC -3'

Sequencing Primer
(F):5'- ACTACTGCCCAGCGCTTTG -3'
(R):5'- CCAATGGTGTGGGCCTTCTG -3'
Posted On2015-12-29