Incidental Mutation 'R4770:Mast3'
ID 367413
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 042410-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4770 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71238864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 480 (T480M)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: T496M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T496M

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: T480M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Meta Mutation Damage Score 0.4734 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 93% (89/96)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,962,341 (GRCm39) V503A possibly damaging Het
Agps T A 2: 75,722,199 (GRCm39) F463Y possibly damaging Het
Ajm1 G A 2: 25,469,759 (GRCm39) R51C possibly damaging Het
Amigo3 A T 9: 107,930,734 (GRCm39) L52F probably damaging Het
Anapc1 T C 2: 128,527,980 (GRCm39) probably benign Het
Ankrd36 G T 11: 5,540,870 (GRCm39) C312F possibly damaging Het
Asic2 A C 11: 80,862,318 (GRCm39) D226E probably benign Het
Atp8b2 T A 3: 89,864,374 (GRCm39) Q197L probably damaging Het
C2cd3 A G 7: 100,092,642 (GRCm39) Y495C probably damaging Het
Ccdc51 A G 9: 108,919,978 (GRCm39) T125A probably benign Het
Ccser1 A G 6: 61,288,485 (GRCm39) Y216C possibly damaging Het
Cimap1b A G 15: 89,263,326 (GRCm39) I19T probably damaging Het
Cntfr A T 4: 41,663,282 (GRCm39) I175N possibly damaging Het
Cox10 G A 11: 63,854,989 (GRCm39) R431W probably benign Het
Cubn T C 2: 13,319,578 (GRCm39) T2881A possibly damaging Het
Cyp2d9 T A 15: 82,336,774 (GRCm39) V41E probably damaging Het
Dmrtb1 C T 4: 107,540,986 (GRCm39) G125D probably benign Het
Dscaml1 C T 9: 45,581,404 (GRCm39) R408C probably damaging Het
Duox2 A T 2: 122,115,397 (GRCm39) S1052T probably benign Het
Ecm1 A G 3: 95,645,273 (GRCm39) probably benign Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Epb41l1 T A 2: 156,371,344 (GRCm39) M727K probably benign Het
Exosc9 T C 3: 36,607,984 (GRCm39) V64A probably damaging Het
Ezh2 A T 6: 47,517,630 (GRCm39) I564N probably damaging Het
Fam89b C A 19: 5,779,482 (GRCm39) R25L probably damaging Het
Fgr C T 4: 132,714,602 (GRCm39) T98M probably damaging Het
Fhip2b T A 14: 70,825,727 (GRCm39) D351V probably damaging Het
Gapvd1 A G 2: 34,581,193 (GRCm39) S1089P probably damaging Het
Gbp5 A T 3: 142,213,837 (GRCm39) I544F possibly damaging Het
Gli2 C A 1: 118,910,318 (GRCm39) probably benign Het
Gm9934 A G 7: 92,702,192 (GRCm39) noncoding transcript Het
Greb1 A T 12: 16,731,357 (GRCm39) D1660E probably benign Het
Gtf2i T A 5: 134,272,414 (GRCm39) N750I possibly damaging Het
H2-DMb2 G C 17: 34,367,698 (GRCm39) D171H probably damaging Het
Il11ra1 A G 4: 41,768,187 (GRCm39) E366G probably damaging Het
Itga2b A G 11: 102,351,582 (GRCm39) F581S probably damaging Het
Itsn2 T A 12: 4,677,892 (GRCm39) M83K probably damaging Het
Kif27 G A 13: 58,492,191 (GRCm39) T316M probably damaging Het
Lad1 A T 1: 135,753,531 (GRCm39) Q26L probably damaging Het
Lrrn3 T A 12: 41,502,442 (GRCm39) H625L probably benign Het
Mast1 A G 8: 85,655,875 (GRCm39) V155A probably benign Het
Mpc1 C T 17: 8,512,377 (GRCm39) probably benign Het
Mycbp2 T A 14: 103,457,380 (GRCm39) M1606L probably benign Het
Myo1c T A 11: 75,551,139 (GRCm39) L238* probably null Het
Nanog T G 6: 122,688,550 (GRCm39) S44A possibly damaging Het
Neb T C 2: 52,039,165 (GRCm39) Q6958R probably benign Het
Ngef C T 1: 87,405,283 (GRCm39) R709H probably damaging Het
Nr1d1 A G 11: 98,661,471 (GRCm39) V265A probably benign Het
Nr3c2 A G 8: 77,634,872 (GRCm39) probably null Het
Olfm5 A G 7: 103,809,685 (GRCm39) S164P probably benign Het
Parvb T C 15: 84,188,106 (GRCm39) probably null Het
Pde4dip G T 3: 97,674,400 (GRCm39) A172D probably damaging Het
Phf2 A G 13: 48,957,079 (GRCm39) L1096P probably damaging Het
Pik3r6 T A 11: 68,420,720 (GRCm39) V155E probably damaging Het
Pinx1 T G 14: 64,109,820 (GRCm39) V124G probably damaging Het
Poglut1 A G 16: 38,355,119 (GRCm39) Y236H probably damaging Het
Pou4f2 T A 8: 79,163,030 (GRCm39) M2L unknown Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Pramel26 C T 4: 143,538,519 (GRCm39) E151K probably damaging Het
Prkaca A G 8: 84,717,499 (GRCm39) N209S probably benign Het
Ring1 G A 17: 34,242,361 (GRCm39) P49S probably damaging Het
Rnf20 T A 4: 49,633,412 (GRCm39) probably null Het
Rnf25 G A 1: 74,633,099 (GRCm39) R418C probably damaging Het
Ryr1 G T 7: 28,808,707 (GRCm39) P462Q probably damaging Het
Serpinb3d A G 1: 107,006,008 (GRCm39) F360S probably damaging Het
Setd7 T C 3: 51,428,843 (GRCm39) E329G probably damaging Het
Slco2b1 C T 7: 99,320,156 (GRCm39) probably null Het
Snap91 G A 9: 86,655,654 (GRCm39) T844I possibly damaging Het
Snhg5 C T 9: 88,404,424 (GRCm39) noncoding transcript Het
Son T A 16: 91,455,756 (GRCm39) V1501E probably damaging Het
Syncrip T A 9: 88,361,905 (GRCm39) E70V probably damaging Het
Tas2r125 A G 6: 132,886,750 (GRCm39) D46G probably damaging Het
Tmem115 G A 9: 107,412,156 (GRCm39) R160Q probably benign Het
Trerf1 G A 17: 47,630,581 (GRCm39) noncoding transcript Het
Tut7 A G 13: 59,920,698 (GRCm39) probably benign Het
Uggt2 A T 14: 119,266,466 (GRCm39) probably null Het
Ush2a G T 1: 188,282,076 (GRCm39) V1864F probably benign Het
Xkr4 A T 1: 3,286,714 (GRCm39) V492D probably damaging Het
Zfp646 T A 7: 127,482,649 (GRCm39) S1609T possibly damaging Het
Zfp65 A T 13: 67,856,477 (GRCm39) H277Q probably damaging Het
Zfp69 A G 4: 120,791,614 (GRCm39) S176P probably damaging Het
Zfp747 C T 7: 126,974,971 (GRCm39) A10T probably damaging Het
Zfp850 T C 7: 27,684,411 (GRCm39) probably null Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCACCCTAAAGGCAGAGC -3'
(R):5'- CATCTTAGAATGCTACCCTGCTG -3'

Sequencing Primer
(F):5'- GCAGGGTCTCTCTGTTGCC -3'
(R):5'- TGCTGGGCAGAACCTATAGACC -3'
Posted On 2015-12-29