Mutagenetix > Incidental Mutation

Incidental Mutation 'R4770:Mast3'

367413

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

042410-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70786220 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 480 (T480M)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: T496M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T496M

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: T480M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Meta Mutation Damage Score

0.4734

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

93% (89/96)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	G	11: 110,071,515	V503A	possibly damaging	Het
Agps	T	A	2: 75,891,855	F463Y	possibly damaging	Het
Amigo3	A	T	9: 108,053,535	L52F	probably damaging	Het
Anapc1	T	C	2: 128,686,060		probably benign	Het
Ankrd36	G	T	11: 5,590,870	C312F	possibly damaging	Het
Asic2	A	C	11: 80,971,492	D226E	probably benign	Het
Atp8b2	T	A	3: 89,957,067	Q197L	probably damaging	Het
C2cd3	A	G	7: 100,443,435	Y495C	probably damaging	Het
Ccdc51	A	G	9: 109,090,910	T125A	probably benign	Het
Ccser1	A	G	6: 61,311,501	Y216C	possibly damaging	Het
Cntfr	A	T	4: 41,663,282	I175N	possibly damaging	Het
Cox10	G	A	11: 63,964,163	R431W	probably benign	Het
Cubn	T	C	2: 13,314,767	T2881A	possibly damaging	Het
Cyp2d9	T	A	15: 82,452,573	V41E	probably damaging	Het
Dmrtb1	C	T	4: 107,683,789	G125D	probably benign	Het
Dscaml1	C	T	9: 45,670,106	R408C	probably damaging	Het
Duox2	A	T	2: 122,284,916	S1052T	probably benign	Het
Ecm1	A	G	3: 95,737,961		probably benign	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Epb41l1	T	A	2: 156,529,424	M727K	probably benign	Het
Exosc9	T	C	3: 36,553,835	V64A	probably damaging	Het
Ezh2	A	T	6: 47,540,696	I564N	probably damaging	Het
Fam160b2	T	A	14: 70,588,287	D351V	probably damaging	Het
Fam89b	C	A	19: 5,729,454	R25L	probably damaging	Het
Fgr	C	T	4: 132,987,291	T98M	probably damaging	Het
Gapvd1	A	G	2: 34,691,181	S1089P	probably damaging	Het
Gbp5	A	T	3: 142,508,076	I544F	possibly damaging	Het
Gli2	C	A	1: 118,982,588		probably benign	Het
Gm13084	C	T	4: 143,811,949	E151K	probably damaging	Het
Gm9934	A	G	7: 93,052,984		noncoding transcript	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Greb1	A	T	12: 16,681,356	D1660E	probably benign	Het
Gtf2i	T	A	5: 134,243,560	N750I	possibly damaging	Het
H2-DMb2	G	C	17: 34,148,724	D171H	probably damaging	Het
Il11ra1	A	G	4: 41,768,187	E366G	probably damaging	Het
Itga2b	A	G	11: 102,460,756	F581S	probably damaging	Het
Itsn2	T	A	12: 4,627,892	M83K	probably damaging	Het
Kif27	G	A	13: 58,344,377	T316M	probably damaging	Het
Lad1	A	T	1: 135,825,793	Q26L	probably damaging	Het
Lrrn3	T	A	12: 41,452,443	H625L	probably benign	Het
Mast1	A	G	8: 84,929,246	V155A	probably benign	Het
Mpc1	C	T	17: 8,293,545		probably benign	Het
Mycbp2	T	A	14: 103,219,944	M1606L	probably benign	Het
Myo1c	T	A	11: 75,660,313	L238*	probably null	Het
Nanog	T	G	6: 122,711,591	S44A	possibly damaging	Het
Neb	T	C	2: 52,149,153	Q6958R	probably benign	Het
Ngef	C	T	1: 87,477,561	R709H	probably damaging	Het
Nr1d1	A	G	11: 98,770,645	V265A	probably benign	Het
Nr3c2	A	G	8: 76,908,243		probably null	Het
Odf3b	A	G	15: 89,379,123	I19T	probably damaging	Het
Olfm5	A	G	7: 104,160,478	S164P	probably benign	Het
Parvb	T	C	15: 84,303,905		probably null	Het
Pde4dip	G	T	3: 97,767,084	A172D	probably damaging	Het
Phf2	A	G	13: 48,803,603	L1096P	probably damaging	Het
Pik3r6	T	A	11: 68,529,894	V155E	probably damaging	Het
Pinx1	T	G	14: 63,872,371	V124G	probably damaging	Het
Poglut1	A	G	16: 38,534,757	Y236H	probably damaging	Het
Pou4f2	T	A	8: 78,436,401	M2L	unknown	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prkaca	A	G	8: 83,990,870	N209S	probably benign	Het
Ring1	G	A	17: 34,023,387	P49S	probably damaging	Het
Rnf20	T	A	4: 49,633,412		probably null	Het
Rnf25	G	A	1: 74,593,940	R418C	probably damaging	Het
Ryr1	G	T	7: 29,109,282	P462Q	probably damaging	Het
Serpinb3d	A	G	1: 107,078,278	F360S	probably damaging	Het
Setd7	T	C	3: 51,521,422	E329G	probably damaging	Het
Slco2b1	C	T	7: 99,670,949		probably null	Het
Snap91	G	A	9: 86,773,601	T844I	possibly damaging	Het
Snhg5	C	T	9: 88,522,371		noncoding transcript	Het
Son	T	A	16: 91,658,868	V1501E	probably damaging	Het
Syncrip	T	A	9: 88,479,852	E70V	probably damaging	Het
Tas2r125	A	G	6: 132,909,787	D46G	probably damaging	Het
Tmem115	G	A	9: 107,534,957	R160Q	probably benign	Het
Trerf1	G	A	17: 47,319,655		noncoding transcript	Het
Uggt2	A	T	14: 119,029,054		probably null	Het
Ush2a	G	T	1: 188,549,879	V1864F	probably benign	Het
Xkr4	A	T	1: 3,216,491	V492D	probably damaging	Het
Zcchc6	A	G	13: 59,772,884		probably benign	Het
Zfp646	T	A	7: 127,883,477	S1609T	possibly damaging	Het
Zfp65	A	T	13: 67,708,358	H277Q	probably damaging	Het
Zfp69	A	G	4: 120,934,417	S176P	probably damaging	Het
Zfp747	C	T	7: 127,375,799	A10T	probably damaging	Het
Zfp850	T	C	7: 27,984,986		probably null	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCACCCTAAAGGCAGAGC -3'
(R):5'- CATCTTAGAATGCTACCCTGCTG -3'

Sequencing Primer
(F):5'- GCAGGGTCTCTCTGTTGCC -3'
(R):5'- TGCTGGGCAGAACCTATAGACC -3'

Posted On

2015-12-29