Mutagenetix > Incidental Mutation

Incidental Mutation 'R4770:Mast1'

367417

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

MMRRC Submission

042410-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4770 (G1)

Quality Score

221

Status

Validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84929246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 155 (V155A)

Ref Sequence

ENSEMBL: ENSMUSP00000105363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

probably benign
Transcript: ENSMUST00000109741
AA Change: V155A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: V155A

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119820
AA Change: V155A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: V155A

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175085

Meta Mutation Damage Score

0.0781

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

93% (89/96)

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	G	11: 110,071,515	V503A	possibly damaging	Het
Agps	T	A	2: 75,891,855	F463Y	possibly damaging	Het
Amigo3	A	T	9: 108,053,535	L52F	probably damaging	Het
Anapc1	T	C	2: 128,686,060		probably benign	Het
Ankrd36	G	T	11: 5,590,870	C312F	possibly damaging	Het
Asic2	A	C	11: 80,971,492	D226E	probably benign	Het
Atp8b2	T	A	3: 89,957,067	Q197L	probably damaging	Het
C2cd3	A	G	7: 100,443,435	Y495C	probably damaging	Het
Ccdc51	A	G	9: 109,090,910	T125A	probably benign	Het
Ccser1	A	G	6: 61,311,501	Y216C	possibly damaging	Het
Cntfr	A	T	4: 41,663,282	I175N	possibly damaging	Het
Cox10	G	A	11: 63,964,163	R431W	probably benign	Het
Cubn	T	C	2: 13,314,767	T2881A	possibly damaging	Het
Cyp2d9	T	A	15: 82,452,573	V41E	probably damaging	Het
Dmrtb1	C	T	4: 107,683,789	G125D	probably benign	Het
Dscaml1	C	T	9: 45,670,106	R408C	probably damaging	Het
Duox2	A	T	2: 122,284,916	S1052T	probably benign	Het
Ecm1	A	G	3: 95,737,961		probably benign	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Epb41l1	T	A	2: 156,529,424	M727K	probably benign	Het
Exosc9	T	C	3: 36,553,835	V64A	probably damaging	Het
Ezh2	A	T	6: 47,540,696	I564N	probably damaging	Het
Fam160b2	T	A	14: 70,588,287	D351V	probably damaging	Het
Fam89b	C	A	19: 5,729,454	R25L	probably damaging	Het
Fgr	C	T	4: 132,987,291	T98M	probably damaging	Het
Gapvd1	A	G	2: 34,691,181	S1089P	probably damaging	Het
Gbp5	A	T	3: 142,508,076	I544F	possibly damaging	Het
Gli2	C	A	1: 118,982,588		probably benign	Het
Gm13084	C	T	4: 143,811,949	E151K	probably damaging	Het
Gm9934	A	G	7: 93,052,984		noncoding transcript	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Greb1	A	T	12: 16,681,356	D1660E	probably benign	Het
Gtf2i	T	A	5: 134,243,560	N750I	possibly damaging	Het
H2-DMb2	G	C	17: 34,148,724	D171H	probably damaging	Het
Il11ra1	A	G	4: 41,768,187	E366G	probably damaging	Het
Itga2b	A	G	11: 102,460,756	F581S	probably damaging	Het
Itsn2	T	A	12: 4,627,892	M83K	probably damaging	Het
Kif27	G	A	13: 58,344,377	T316M	probably damaging	Het
Lad1	A	T	1: 135,825,793	Q26L	probably damaging	Het
Lrrn3	T	A	12: 41,452,443	H625L	probably benign	Het
Mast3	G	A	8: 70,786,220	T480M	probably damaging	Het
Mpc1	C	T	17: 8,293,545		probably benign	Het
Mycbp2	T	A	14: 103,219,944	M1606L	probably benign	Het
Myo1c	T	A	11: 75,660,313	L238*	probably null	Het
Nanog	T	G	6: 122,711,591	S44A	possibly damaging	Het
Neb	T	C	2: 52,149,153	Q6958R	probably benign	Het
Ngef	C	T	1: 87,477,561	R709H	probably damaging	Het
Nr1d1	A	G	11: 98,770,645	V265A	probably benign	Het
Nr3c2	A	G	8: 76,908,243		probably null	Het
Odf3b	A	G	15: 89,379,123	I19T	probably damaging	Het
Olfm5	A	G	7: 104,160,478	S164P	probably benign	Het
Parvb	T	C	15: 84,303,905		probably null	Het
Pde4dip	G	T	3: 97,767,084	A172D	probably damaging	Het
Phf2	A	G	13: 48,803,603	L1096P	probably damaging	Het
Pik3r6	T	A	11: 68,529,894	V155E	probably damaging	Het
Pinx1	T	G	14: 63,872,371	V124G	probably damaging	Het
Poglut1	A	G	16: 38,534,757	Y236H	probably damaging	Het
Pou4f2	T	A	8: 78,436,401	M2L	unknown	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prkaca	A	G	8: 83,990,870	N209S	probably benign	Het
Ring1	G	A	17: 34,023,387	P49S	probably damaging	Het
Rnf20	T	A	4: 49,633,412		probably null	Het
Rnf25	G	A	1: 74,593,940	R418C	probably damaging	Het
Ryr1	G	T	7: 29,109,282	P462Q	probably damaging	Het
Serpinb3d	A	G	1: 107,078,278	F360S	probably damaging	Het
Setd7	T	C	3: 51,521,422	E329G	probably damaging	Het
Slco2b1	C	T	7: 99,670,949		probably null	Het
Snap91	G	A	9: 86,773,601	T844I	possibly damaging	Het
Snhg5	C	T	9: 88,522,371		noncoding transcript	Het
Son	T	A	16: 91,658,868	V1501E	probably damaging	Het
Syncrip	T	A	9: 88,479,852	E70V	probably damaging	Het
Tas2r125	A	G	6: 132,909,787	D46G	probably damaging	Het
Tmem115	G	A	9: 107,534,957	R160Q	probably benign	Het
Trerf1	G	A	17: 47,319,655		noncoding transcript	Het
Uggt2	A	T	14: 119,029,054		probably null	Het
Ush2a	G	T	1: 188,549,879	V1864F	probably benign	Het
Xkr4	A	T	1: 3,216,491	V492D	probably damaging	Het
Zcchc6	A	G	13: 59,772,884		probably benign	Het
Zfp646	T	A	7: 127,883,477	S1609T	possibly damaging	Het
Zfp65	A	T	13: 67,708,358	H277Q	probably damaging	Het
Zfp69	A	G	4: 120,934,417	S176P	probably damaging	Het
Zfp747	C	T	7: 127,375,799	A10T	probably damaging	Het
Zfp850	T	C	7: 27,984,986		probably null	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	splice site	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	84921415	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	84921125	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	84921361	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5463:Mast1	UTSW	8	84925507	missense	probably damaging	1.00
R5546:Mast1	UTSW	8	84916260	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	84917754	missense	probably benign
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7164:Mast1	UTSW	8	84935304	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R8167:Mast1	UTSW	8	84921358	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	84912821	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	84916324	missense	probably damaging	1.00
R9477:Mast1	UTSW	8	84912150	missense	probably benign	0.18
R9526:Mast1	UTSW	8	84921176	missense	probably damaging	1.00
R9557:Mast1	UTSW	8	84930845	missense	probably damaging	1.00
R9655:Mast1	UTSW	8	84924031	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AGAAGTTCATCCTGTCCAGTC -3'
(R):5'- GGTTCTGCATAGCAATCTTCCC -3'

Sequencing Primer
(F):5'- GACTTAGTGTTGCCCCGC -3'
(R):5'- TCTTAAGCGCTGGGATCACAG -3'

Posted On

2015-12-29