Incidental Mutation 'R0412:Ttc7'
ID36743
Institutional Source Beutler Lab
Gene Symbol Ttc7
Ensembl Gene ENSMUSG00000036918
Gene Nametetratricopeptide repeat domain 7
Synonyms1110035E02Rik, fsn, hea, 1700007L07Rik
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R0412 (G1)
Quality Score218
Status Validated
Chromosome17
Chromosomal Location87282886-87381769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87330044 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 409 (K409R)
Ref Sequence ENSEMBL: ENSMUSP00000115351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041110] [ENSMUST00000125875] [ENSMUST00000144204] [ENSMUST00000154255]
Predicted Effect probably benign
Transcript: ENSMUST00000041110
AA Change: K409R

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040771
Gene: ENSMUSG00000036918
AA Change: K409R

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 8.7e-4 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
TPR 779 812 9.99e1 SMART
TPR 813 846 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125875
AA Change: K409R

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115351
Gene: ENSMUSG00000036918
AA Change: K409R

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 1.2e-3 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
low complexity region 787 801 N/A INTRINSIC
low complexity region 806 818 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127970
Predicted Effect probably benign
Transcript: ENSMUST00000144204
SMART Domains Protein: ENSMUSP00000122563
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153014
Predicted Effect probably benign
Transcript: ENSMUST00000154255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161043
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeats. Mutations in this gene disrupt intestinal development and can cause early onset inflammatory bowel disease and intestinal atresia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit reduced growth, sparse hair, thickened, scaly skin, increased numbers of splenic B cells, macrophages, and erythroid cells, elevated IgE, glomerulonephritis, and forestomach papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Ttc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ttc7 APN 17 87363564 missense possibly damaging 0.66
IGL00980:Ttc7 APN 17 87321446 missense possibly damaging 0.82
IGL01638:Ttc7 APN 17 87359112 critical splice acceptor site probably null
IGL01896:Ttc7 APN 17 87359124 missense probably damaging 0.99
IGL02643:Ttc7 APN 17 87340899 missense possibly damaging 0.85
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0310:Ttc7 UTSW 17 87361864 missense probably benign 0.00
R0520:Ttc7 UTSW 17 87359151 missense possibly damaging 0.93
R1216:Ttc7 UTSW 17 87346578 missense possibly damaging 0.85
R1262:Ttc7 UTSW 17 87340936 missense probably benign 0.09
R1337:Ttc7 UTSW 17 87290296 missense probably damaging 1.00
R1537:Ttc7 UTSW 17 87322463 missense possibly damaging 0.88
R1586:Ttc7 UTSW 17 87361945 critical splice donor site probably null
R1678:Ttc7 UTSW 17 87361901 missense probably damaging 1.00
R1747:Ttc7 UTSW 17 87307015 missense possibly damaging 0.87
R2146:Ttc7 UTSW 17 87346707 splice site probably benign
R3878:Ttc7 UTSW 17 87370738 intron probably benign
R3934:Ttc7 UTSW 17 87370738 intron probably benign
R4007:Ttc7 UTSW 17 87290251 missense possibly damaging 0.69
R4256:Ttc7 UTSW 17 87321401 critical splice acceptor site probably null
R4671:Ttc7 UTSW 17 87346620 missense probably damaging 1.00
R4676:Ttc7 UTSW 17 87370735 intron probably benign
R4677:Ttc7 UTSW 17 87370735 intron probably benign
R4784:Ttc7 UTSW 17 87340897 missense probably benign 0.03
R4833:Ttc7 UTSW 17 87334321 missense probably damaging 1.00
R4927:Ttc7 UTSW 17 87346705 splice site probably null
R4940:Ttc7 UTSW 17 87306958 missense probably benign 0.02
R5183:Ttc7 UTSW 17 87292878 missense probably damaging 1.00
R5634:Ttc7 UTSW 17 87342087 missense probably benign
R5710:Ttc7 UTSW 17 87290246 missense probably damaging 1.00
R5867:Ttc7 UTSW 17 87322472 missense possibly damaging 0.49
R6437:Ttc7 UTSW 17 87330106 missense probably damaging 1.00
R6982:Ttc7 UTSW 17 87307009 missense probably damaging 1.00
R7299:Ttc7 UTSW 17 87346542 missense possibly damaging 0.68
R7849:Ttc7 UTSW 17 87292946 missense probably null 0.00
R8098:Ttc7 UTSW 17 87334328 missense probably benign 0.21
R8471:Ttc7 UTSW 17 87294026 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GATTGTCCCTGTATTCCCAGGCTG -3'
(R):5'- TATCATCGACCCTCTTAGGCACGC -3'

Sequencing Primer
(F):5'- GGTCATGGTTAGCCTGTGAG -3'
(R):5'- TCAGGGAGTCATCCCAATACTG -3'
Posted On2013-05-09