Incidental Mutation 'R4770:Itsn2'
ID367433
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 042410-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4770 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4627892 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 83 (M83K)
Ref Sequence ENSEMBL: ENSMUSP00000151663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000218402] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect unknown
Transcript: ENSMUST00000062580
AA Change: M83K
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: M83K

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218072
Predicted Effect probably damaging
Transcript: ENSMUST00000218402
AA Change: M83K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000219007
AA Change: M83K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect unknown
Transcript: ENSMUST00000220311
AA Change: M83K
Meta Mutation Damage Score 0.9090 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 93% (89/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,071,515 V503A possibly damaging Het
Agps T A 2: 75,891,855 F463Y possibly damaging Het
Amigo3 A T 9: 108,053,535 L52F probably damaging Het
Anapc1 T C 2: 128,686,060 probably benign Het
Ankrd36 G T 11: 5,590,870 C312F possibly damaging Het
Asic2 A C 11: 80,971,492 D226E probably benign Het
Atp8b2 T A 3: 89,957,067 Q197L probably damaging Het
C2cd3 A G 7: 100,443,435 Y495C probably damaging Het
Ccdc51 A G 9: 109,090,910 T125A probably benign Het
Ccser1 A G 6: 61,311,501 Y216C possibly damaging Het
Cntfr A T 4: 41,663,282 I175N possibly damaging Het
Cox10 G A 11: 63,964,163 R431W probably benign Het
Cubn T C 2: 13,314,767 T2881A possibly damaging Het
Cyp2d9 T A 15: 82,452,573 V41E probably damaging Het
Dmrtb1 C T 4: 107,683,789 G125D probably benign Het
Dscaml1 C T 9: 45,670,106 R408C probably damaging Het
Duox2 A T 2: 122,284,916 S1052T probably benign Het
Ecm1 A G 3: 95,737,961 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Epb41l1 T A 2: 156,529,424 M727K probably benign Het
Exosc9 T C 3: 36,553,835 V64A probably damaging Het
Ezh2 A T 6: 47,540,696 I564N probably damaging Het
Fam160b2 T A 14: 70,588,287 D351V probably damaging Het
Fam89b C A 19: 5,729,454 R25L probably damaging Het
Fgr C T 4: 132,987,291 T98M probably damaging Het
Gapvd1 A G 2: 34,691,181 S1089P probably damaging Het
Gbp5 A T 3: 142,508,076 I544F possibly damaging Het
Gli2 C A 1: 118,982,588 probably benign Het
Gm13084 C T 4: 143,811,949 E151K probably damaging Het
Gm9934 A G 7: 93,052,984 noncoding transcript Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Greb1 A T 12: 16,681,356 D1660E probably benign Het
Gtf2i T A 5: 134,243,560 N750I possibly damaging Het
H2-DMb2 G C 17: 34,148,724 D171H probably damaging Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Itga2b A G 11: 102,460,756 F581S probably damaging Het
Kif27 G A 13: 58,344,377 T316M probably damaging Het
Lad1 A T 1: 135,825,793 Q26L probably damaging Het
Lrrn3 T A 12: 41,452,443 H625L probably benign Het
Mast1 A G 8: 84,929,246 V155A probably benign Het
Mast3 G A 8: 70,786,220 T480M probably damaging Het
Mpc1 C T 17: 8,293,545 probably benign Het
Mycbp2 T A 14: 103,219,944 M1606L probably benign Het
Myo1c T A 11: 75,660,313 L238* probably null Het
Nanog T G 6: 122,711,591 S44A possibly damaging Het
Neb T C 2: 52,149,153 Q6958R probably benign Het
Ngef C T 1: 87,477,561 R709H probably damaging Het
Nr1d1 A G 11: 98,770,645 V265A probably benign Het
Nr3c2 A G 8: 76,908,243 probably null Het
Odf3b A G 15: 89,379,123 I19T probably damaging Het
Olfm5 A G 7: 104,160,478 S164P probably benign Het
Parvb T C 15: 84,303,905 probably null Het
Pde4dip G T 3: 97,767,084 A172D probably damaging Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Pik3r6 T A 11: 68,529,894 V155E probably damaging Het
Pinx1 T G 14: 63,872,371 V124G probably damaging Het
Poglut1 A G 16: 38,534,757 Y236H probably damaging Het
Pou4f2 T A 8: 78,436,401 M2L unknown Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkaca A G 8: 83,990,870 N209S probably benign Het
Ring1 G A 17: 34,023,387 P49S probably damaging Het
Rnf20 T A 4: 49,633,412 probably null Het
Rnf25 G A 1: 74,593,940 R418C probably damaging Het
Ryr1 G T 7: 29,109,282 P462Q probably damaging Het
Serpinb3d A G 1: 107,078,278 F360S probably damaging Het
Setd7 T C 3: 51,521,422 E329G probably damaging Het
Slco2b1 C T 7: 99,670,949 probably null Het
Snap91 G A 9: 86,773,601 T844I possibly damaging Het
Snhg5 C T 9: 88,522,371 noncoding transcript Het
Son T A 16: 91,658,868 V1501E probably damaging Het
Syncrip T A 9: 88,479,852 E70V probably damaging Het
Tas2r125 A G 6: 132,909,787 D46G probably damaging Het
Tmem115 G A 9: 107,534,957 R160Q probably benign Het
Trerf1 G A 17: 47,319,655 noncoding transcript Het
Uggt2 A T 14: 119,029,054 probably null Het
Ush2a G T 1: 188,549,879 V1864F probably benign Het
Xkr4 A T 1: 3,216,491 V492D probably damaging Het
Zcchc6 A G 13: 59,772,884 probably benign Het
Zfp646 T A 7: 127,883,477 S1609T possibly damaging Het
Zfp65 A T 13: 67,708,358 H277Q probably damaging Het
Zfp69 A G 4: 120,934,417 S176P probably damaging Het
Zfp747 C T 7: 127,375,799 A10T probably damaging Het
Zfp850 T C 7: 27,984,986 probably null Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
Gopher UTSW 12 4706983 nonsense probably null
inversus UTSW 12 4639670 nonsense probably null
Liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
Stratofortress UTSW 12 4624927 missense probably damaging 1.00
Vole UTSW 12 4673420 nonsense probably null
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
R7814:Itsn2 UTSW 12 4658561 missense probably benign 0.14
R7854:Itsn2 UTSW 12 4701276 missense probably damaging 1.00
R7879:Itsn2 UTSW 12 4701265 missense probably benign 0.16
R7990:Itsn2 UTSW 12 4635629 missense unknown
R8009:Itsn2 UTSW 12 4664553 missense probably benign 0.12
R8115:Itsn2 UTSW 12 4673602 missense possibly damaging 0.90
R8143:Itsn2 UTSW 12 4633003 missense unknown
R8248:Itsn2 UTSW 12 4662052 missense probably benign 0.00
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTACATGTGAATGCTTTGCC -3'
(R):5'- CCAGACAGGGACACTTAGCTATG -3'

Sequencing Primer
(F):5'- CATGTGAATGCTTTGCCATTGTTTTC -3'
(R):5'- AACTTGGAAGTCTAGGGATTGTC -3'
Posted On2015-12-29