Mutagenetix > Incidental Mutation

Incidental Mutation 'R4770:Lrrn3'

367435

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

042410-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.203) question?

Stock #

R4770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41452443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 625 (H625L)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

AlphaFold

Q8CBC6

Predicted Effect

probably benign
Transcript: ENSMUST00000043884
AA Change: H625L

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: H625L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

93% (89/96)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	G	11: 110,071,515	V503A	possibly damaging	Het
Agps	T	A	2: 75,891,855	F463Y	possibly damaging	Het
Amigo3	A	T	9: 108,053,535	L52F	probably damaging	Het
Anapc1	T	C	2: 128,686,060		probably benign	Het
Ankrd36	G	T	11: 5,590,870	C312F	possibly damaging	Het
Asic2	A	C	11: 80,971,492	D226E	probably benign	Het
Atp8b2	T	A	3: 89,957,067	Q197L	probably damaging	Het
C2cd3	A	G	7: 100,443,435	Y495C	probably damaging	Het
Ccdc51	A	G	9: 109,090,910	T125A	probably benign	Het
Ccser1	A	G	6: 61,311,501	Y216C	possibly damaging	Het
Cntfr	A	T	4: 41,663,282	I175N	possibly damaging	Het
Cox10	G	A	11: 63,964,163	R431W	probably benign	Het
Cubn	T	C	2: 13,314,767	T2881A	possibly damaging	Het
Cyp2d9	T	A	15: 82,452,573	V41E	probably damaging	Het
Dmrtb1	C	T	4: 107,683,789	G125D	probably benign	Het
Dscaml1	C	T	9: 45,670,106	R408C	probably damaging	Het
Duox2	A	T	2: 122,284,916	S1052T	probably benign	Het
Ecm1	A	G	3: 95,737,961		probably benign	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Epb41l1	T	A	2: 156,529,424	M727K	probably benign	Het
Exosc9	T	C	3: 36,553,835	V64A	probably damaging	Het
Ezh2	A	T	6: 47,540,696	I564N	probably damaging	Het
Fam160b2	T	A	14: 70,588,287	D351V	probably damaging	Het
Fam89b	C	A	19: 5,729,454	R25L	probably damaging	Het
Fgr	C	T	4: 132,987,291	T98M	probably damaging	Het
Gapvd1	A	G	2: 34,691,181	S1089P	probably damaging	Het
Gbp5	A	T	3: 142,508,076	I544F	possibly damaging	Het
Gli2	C	A	1: 118,982,588		probably benign	Het
Gm13084	C	T	4: 143,811,949	E151K	probably damaging	Het
Gm9934	A	G	7: 93,052,984		noncoding transcript	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Greb1	A	T	12: 16,681,356	D1660E	probably benign	Het
Gtf2i	T	A	5: 134,243,560	N750I	possibly damaging	Het
H2-DMb2	G	C	17: 34,148,724	D171H	probably damaging	Het
Il11ra1	A	G	4: 41,768,187	E366G	probably damaging	Het
Itga2b	A	G	11: 102,460,756	F581S	probably damaging	Het
Itsn2	T	A	12: 4,627,892	M83K	probably damaging	Het
Kif27	G	A	13: 58,344,377	T316M	probably damaging	Het
Lad1	A	T	1: 135,825,793	Q26L	probably damaging	Het
Mast1	A	G	8: 84,929,246	V155A	probably benign	Het
Mast3	G	A	8: 70,786,220	T480M	probably damaging	Het
Mpc1	C	T	17: 8,293,545		probably benign	Het
Mycbp2	T	A	14: 103,219,944	M1606L	probably benign	Het
Myo1c	T	A	11: 75,660,313	L238*	probably null	Het
Nanog	T	G	6: 122,711,591	S44A	possibly damaging	Het
Neb	T	C	2: 52,149,153	Q6958R	probably benign	Het
Ngef	C	T	1: 87,477,561	R709H	probably damaging	Het
Nr1d1	A	G	11: 98,770,645	V265A	probably benign	Het
Nr3c2	A	G	8: 76,908,243		probably null	Het
Odf3b	A	G	15: 89,379,123	I19T	probably damaging	Het
Olfm5	A	G	7: 104,160,478	S164P	probably benign	Het
Parvb	T	C	15: 84,303,905		probably null	Het
Pde4dip	G	T	3: 97,767,084	A172D	probably damaging	Het
Phf2	A	G	13: 48,803,603	L1096P	probably damaging	Het
Pik3r6	T	A	11: 68,529,894	V155E	probably damaging	Het
Pinx1	T	G	14: 63,872,371	V124G	probably damaging	Het
Poglut1	A	G	16: 38,534,757	Y236H	probably damaging	Het
Pou4f2	T	A	8: 78,436,401	M2L	unknown	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prkaca	A	G	8: 83,990,870	N209S	probably benign	Het
Ring1	G	A	17: 34,023,387	P49S	probably damaging	Het
Rnf20	T	A	4: 49,633,412		probably null	Het
Rnf25	G	A	1: 74,593,940	R418C	probably damaging	Het
Ryr1	G	T	7: 29,109,282	P462Q	probably damaging	Het
Serpinb3d	A	G	1: 107,078,278	F360S	probably damaging	Het
Setd7	T	C	3: 51,521,422	E329G	probably damaging	Het
Slco2b1	C	T	7: 99,670,949		probably null	Het
Snap91	G	A	9: 86,773,601	T844I	possibly damaging	Het
Snhg5	C	T	9: 88,522,371		noncoding transcript	Het
Son	T	A	16: 91,658,868	V1501E	probably damaging	Het
Syncrip	T	A	9: 88,479,852	E70V	probably damaging	Het
Tas2r125	A	G	6: 132,909,787	D46G	probably damaging	Het
Tmem115	G	A	9: 107,534,957	R160Q	probably benign	Het
Trerf1	G	A	17: 47,319,655		noncoding transcript	Het
Uggt2	A	T	14: 119,029,054		probably null	Het
Ush2a	G	T	1: 188,549,879	V1864F	probably benign	Het
Xkr4	A	T	1: 3,216,491	V492D	probably damaging	Het
Zcchc6	A	G	13: 59,772,884		probably benign	Het
Zfp646	T	A	7: 127,883,477	S1609T	possibly damaging	Het
Zfp65	A	T	13: 67,708,358	H277Q	probably damaging	Het
Zfp69	A	G	4: 120,934,417	S176P	probably damaging	Het
Zfp747	C	T	7: 127,375,799	A10T	probably damaging	Het
Zfp850	T	C	7: 27,984,986		probably null	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0414:Lrrn3	UTSW	12	41453940	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4408:Lrrn3	UTSW	12	41454042	missense	probably benign	0.04
R4410:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4927:Lrrn3	UTSW	12	41453125	missense	probably damaging	1.00
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6129:Lrrn3	UTSW	12	41453788	nonsense	probably null
R6309:Lrrn3	UTSW	12	41453206	missense	probably damaging	1.00
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8059:Lrrn3	UTSW	12	41454217	missense	probably benign	0.22
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00
R8798:Lrrn3	UTSW	12	41453175	missense	possibly damaging	0.61
R9308:Lrrn3	UTSW	12	41453946	missense	probably damaging	1.00
R9318:Lrrn3	UTSW	12	41453244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGACTCCCAGAGGTTGATTAG -3'
(R):5'- GCGTTAAGTGGACAGCCTTTG -3'

Sequencing Primer
(F):5'- CTCCCAGAGGTTGATTAGAGGAG -3'
(R):5'- GTCAAGACTGAAGACTCTCATGCTG -3'

Posted On

2015-12-29