Incidental Mutation 'R4771:Pax6'
ID367467
Institutional Source Beutler Lab
Gene Symbol Pax6
Ensembl Gene ENSMUSG00000027168
Gene Namepaired box 6
SynonymsGsfaey11, Dey, Dickie's small eye, AEY11, Pax-6, 1500038E17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4771 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location105668900-105697364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105696502 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 251 (P251Q)
Ref Sequence ENSEMBL: ENSMUSP00000106717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090391] [ENSMUST00000090397] [ENSMUST00000111082] [ENSMUST00000111083] [ENSMUST00000111085] [ENSMUST00000111086] [ENSMUST00000111087] [ENSMUST00000111088] [ENSMUST00000122965] [ENSMUST00000167211]
Predicted Effect probably benign
Transcript: ENSMUST00000090391
SMART Domains Protein: ENSMUSP00000087870
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090397
SMART Domains Protein: ENSMUSP00000087878
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111082
SMART Domains Protein: ENSMUSP00000106711
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111083
SMART Domains Protein: ENSMUSP00000106712
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111085
SMART Domains Protein: ENSMUSP00000106714
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111086
SMART Domains Protein: ENSMUSP00000106715
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111087
SMART Domains Protein: ENSMUSP00000106716
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111088
AA Change: P251Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106717
Gene: ENSMUSG00000027168
AA Change: P251Q

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
HOX 39 101 4.93e-26 SMART
low complexity region 110 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122965
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123063
SMART Domains Protein: ENSMUSP00000121345
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
HOX 9 71 2.5e-28 SMART
low complexity region 80 93 N/A INTRINSIC
Blast:PAX 121 169 6e-24 BLAST
low complexity region 186 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138365
SMART Domains Protein: ENSMUSP00000117154
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
PAX 33 192 4.87e-77 SMART
low complexity region 238 249 N/A INTRINSIC
SCOP:d1b72a_ 254 291 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146803
SMART Domains Protein: ENSMUSP00000133346
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
Blast:PAX 1 62 1e-26 BLAST
HOX 74 136 4.93e-26 SMART
low complexity region 145 158 N/A INTRINSIC
Blast:PAX 186 234 3e-23 BLAST
low complexity region 251 259 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153011
SMART Domains Protein: ENSMUSP00000118457
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 2 109 4.98e-42 SMART
low complexity region 155 166 N/A INTRINSIC
Pfam:Homeobox 192 218 7.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155081
Predicted Effect probably benign
Transcript: ENSMUST00000167211
SMART Domains Protein: ENSMUSP00000129344
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homeobox-containing protein that functions as a regulator of transcription. It plays a key role in the development of neural tissues, particularly the eye. Activity of this protein is also required for expression of glucagon in the pancreas. This gene is regulated by multiple enhancers located up to tens or hundreds of kilobases upstream and downstream of the transcription start sites. Mutations in this gene or deletion of these regulatory elements results in severe defects in eye development. Alternative splicing and the use of alternative promoters results in multiple transcript variants, some of which encode proteins that lack the N-terminal paired domain. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null and hypomorphic mutants show a range of phenotypes from viable with small eyes and lens/cornea fusion to microphthalmia and cataract to embryonic or perinatal lethality with anophthalmia and severe craniofacial and forebrain defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,558,973 L190P probably damaging Het
2310022B05Rik T C 8: 124,639,561 T148A probably benign Het
Abcc4 G T 14: 118,484,384 N1234K probably benign Het
Adamts20 C T 15: 94,351,635 probably null Het
Aqp9 C T 9: 71,122,870 G212S probably damaging Het
Asb15 A T 6: 24,570,622 N533I probably damaging Het
Brwd1 A G 16: 96,003,318 V1884A probably benign Het
Casc4 T A 2: 121,925,645 V352E probably damaging Het
Ccdc106 G A 7: 5,057,522 probably null Het
Cfap46 A T 7: 139,630,608 L1774Q probably null Het
Clec2h G A 6: 128,674,155 E133K probably damaging Het
Cntn1 T A 15: 92,305,091 F751L possibly damaging Het
Col20a1 A T 2: 180,989,124 M62L probably benign Het
Col7a1 T C 9: 108,971,925 V1899A probably damaging Het
Cpa5 T A 6: 30,612,685 L28* probably null Het
Crb1 T A 1: 139,328,204 E264D probably damaging Het
Creb3l2 A T 6: 37,334,577 S426T probably benign Het
Cspg5 T A 9: 110,251,127 N373K probably damaging Het
Ctso T C 3: 81,932,740 S26P probably benign Het
Depdc1b A C 13: 108,382,900 D348A probably benign Het
Diaph1 A T 18: 37,853,551 M1127K probably damaging Het
Dlgap1 A T 17: 70,593,380 K397* probably null Het
Dock3 T A 9: 106,952,358 H1119L possibly damaging Het
Dok4 G T 8: 94,865,167 probably null Het
Dram2 A G 3: 106,573,045 T225A probably damaging Het
Dst G A 1: 34,249,484 R5603H probably damaging Het
Ehbp1l1 A G 19: 5,725,968 F18S probably damaging Het
Epha5 A G 5: 84,150,419 V427A probably damaging Het
Exoc4 A T 6: 33,441,949 probably null Het
Exph5 C T 9: 53,373,665 T682I possibly damaging Het
Fam35a G A 14: 34,268,706 T81M probably damaging Het
Fam92a T A 4: 12,155,689 Q311L probably benign Het
Fnbp1l A T 3: 122,558,103 S264T possibly damaging Het
Ggnbp2 A T 11: 84,834,488 D580E probably benign Het
Gm10277 G A 11: 77,785,708 probably benign Het
Gtf2a1l C A 17: 88,690,020 P93Q probably benign Het
Hydin A T 8: 110,532,883 I2496F probably benign Het
Ighv7-2 A C 12: 113,912,467 I6S probably benign Het
Irs1 A G 1: 82,287,975 V840A probably benign Het
Itgal A G 7: 127,328,233 E965G probably damaging Het
Izumo1 T G 7: 45,622,809 F5V probably benign Het
Izumo1 T A 7: 45,622,810 F5Y probably damaging Het
Kif13a A G 13: 46,825,211 S175P probably damaging Het
Klf14 A G 6: 30,958,025 F225L probably damaging Het
Kpna1 T C 16: 36,033,403 Y468H probably damaging Het
Krt5 T A 15: 101,709,059 Q413L probably damaging Het
Lbr T C 1: 181,838,421 Y41C probably damaging Het
Lmcd1 A T 6: 112,315,873 N229Y probably damaging Het
March3 T A 18: 56,783,098 H175L probably benign Het
Mcmbp A G 7: 128,698,400 probably null Het
Med27 T A 2: 29,413,503 L16Q probably damaging Het
Mex3b A T 7: 82,869,065 Q196L possibly damaging Het
Mga T C 2: 119,964,294 S2820P probably damaging Het
Mroh2a C T 1: 88,251,365 L1104F probably damaging Het
Mta3 A G 17: 83,755,674 E166G probably damaging Het
Mthfd2l A G 5: 90,948,868 E116G possibly damaging Het
Musk A G 4: 58,301,706 I155V probably benign Het
Myh7b G A 2: 155,626,394 W834* probably null Het
Myo18b T A 5: 112,692,227 R2567* probably null Het
Nars2 A T 7: 97,035,245 E325V probably damaging Het
Nploc4 A G 11: 120,421,434 V106A possibly damaging Het
Nudcd1 A T 15: 44,405,482 S167R probably damaging Het
Nup133 T A 8: 123,929,398 D448V probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr495 A T 7: 108,396,022 K301* probably null Het
Pcdh8 C T 14: 79,768,270 A893T possibly damaging Het
Per3 A T 4: 151,009,259 V1033E probably damaging Het
Polr1e T C 4: 45,019,282 S44P probably damaging Het
Pou4f2 T A 8: 78,435,236 H246L possibly damaging Het
Psmd2 G A 16: 20,662,679 R828Q probably damaging Het
Ptprq A G 10: 107,688,427 S482P probably benign Het
Rbm14 G T 19: 4,802,643 probably benign Het
Reln T C 5: 22,049,700 D557G probably damaging Het
Rhobtb2 A G 14: 69,797,050 I242T probably benign Het
Runx1 C A 16: 92,695,741 V5L possibly damaging Het
Slc13a1 A T 6: 24,100,340 Y381* probably null Het
Smyd3 A T 1: 179,094,396 C180S probably damaging Het
Sntg2 T A 12: 30,276,659 probably null Het
Snx19 G A 9: 30,433,638 V678I probably damaging Het
Spag5 G A 11: 78,304,766 A300T probably damaging Het
Spdl1 T A 11: 34,813,327 R560W probably damaging Het
Spen T C 4: 141,472,596 T2884A probably benign Het
Spg11 G A 2: 122,065,482 Q1752* probably null Het
Srrm4 C A 5: 116,475,175 probably null Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Sspo A G 6: 48,460,879 D1324G probably damaging Het
Tkt T G 14: 30,567,025 I238S probably damaging Het
Tmem184b A T 15: 79,377,177 N76K probably benign Het
Trpm6 A G 19: 18,813,493 M631V probably damaging Het
Ttll6 A C 11: 96,133,829 E15A possibly damaging Het
Ttn T C 2: 76,738,952 D27199G probably damaging Het
Ubn2 A T 6: 38,487,153 probably null Het
Ubr5 A C 15: 38,018,297 I866M possibly damaging Het
Urb1 T C 16: 90,753,518 T2149A probably benign Het
Ush2a G T 1: 188,797,769 V3252L possibly damaging Het
Usp24 A G 4: 106,362,180 probably null Het
Vill T A 9: 119,068,434 M259K probably damaging Het
Vldlr T C 19: 27,239,890 I411T probably damaging Het
Vmn2r120 A T 17: 57,524,887 W301R probably damaging Het
Vps13b G A 15: 35,910,800 S3570N probably damaging Het
Vps13c T C 9: 67,929,539 V1773A probably benign Het
Vtn A G 11: 78,501,574 D326G probably benign Het
Wdr93 A T 7: 79,776,763 H592L probably damaging Het
Zdhhc19 A G 16: 32,499,135 D94G probably damaging Het
Zfand4 A T 6: 116,314,350 E188V probably damaging Het
Zfp523 C A 17: 28,201,338 probably null Het
Zfp536 T C 7: 37,568,884 D369G probably damaging Het
Zfp608 T A 18: 54,988,300 T72S probably benign Het
Zfp804a T A 2: 82,257,942 V705E probably benign Het
Zfp974 T C 7: 27,926,308 T46A probably damaging Het
Zkscan4 C T 13: 21,479,246 Q52* probably null Het
Other mutations in Pax6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Pax6 APN 2 105692278 critical splice donor site probably null
IGL02256:Pax6 APN 2 105684770 missense probably benign 0.16
IGL02500:Pax6 APN 2 105692770 missense probably benign 0.13
red_hots UTSW 2 105695360 missense probably benign 0.00
R1067:Pax6 UTSW 2 105680301 missense probably benign 0.01
R1213:Pax6 UTSW 2 105685913 missense probably benign 0.13
R1494:Pax6 UTSW 2 105691610 missense probably benign 0.16
R1633:Pax6 UTSW 2 105691718 missense probably damaging 1.00
R2291:Pax6 UTSW 2 105685883 missense probably benign 0.09
R3834:Pax6 UTSW 2 105696450 missense probably benign 0.00
R3835:Pax6 UTSW 2 105696450 missense probably benign 0.00
R4665:Pax6 UTSW 2 105683998 intron probably benign
R4714:Pax6 UTSW 2 105695400 missense possibly damaging 0.74
R4747:Pax6 UTSW 2 105696502 missense probably benign
R4764:Pax6 UTSW 2 105696502 missense probably benign
R4767:Pax6 UTSW 2 105695360 missense probably benign 0.00
R4772:Pax6 UTSW 2 105696502 missense probably benign
R4816:Pax6 UTSW 2 105683784 intron probably benign
R4819:Pax6 UTSW 2 105692277 critical splice donor site probably null
R5418:Pax6 UTSW 2 105691565 missense probably benign 0.00
R5683:Pax6 UTSW 2 105685907 missense probably benign 0.06
R6041:Pax6 UTSW 2 105683902 missense probably damaging 1.00
R6263:Pax6 UTSW 2 105692854 critical splice donor site probably null
R6651:Pax6 UTSW 2 105685830 missense probably benign 0.00
R6822:Pax6 UTSW 2 105685923 missense probably benign 0.04
R7042:Pax6 UTSW 2 105696373 missense probably benign
R7088:Pax6 UTSW 2 105696408 missense probably benign 0.00
R7102:Pax6 UTSW 2 105692259 missense probably damaging 0.98
R7294:Pax6 UTSW 2 105684901 nonsense probably null
R7761:Pax6 UTSW 2 105691691 missense probably damaging 1.00
R7948:Pax6 UTSW 2 105685877 missense probably benign
Z1177:Pax6 UTSW 2 105685816 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTCAGTACTGGCCTCGATTAC -3'
(R):5'- AATCCATGGCAAATCTTGTCGATC -3'

Sequencing Primer
(F):5'- CAGTACTGGCCTCGATTACAGTAAAG -3'
(R):5'- GCAAATCTTGTCGATCATGGTTTC -3'
Posted On2015-12-29