Incidental Mutation 'R0412:Dntt'
ID 36748
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Name deoxynucleotidyltransferase, terminal
Synonyms Tdt
MMRRC Submission 038614-MU
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0412 (G1)
Quality Score 132
Status Validated
Chromosome 19
Chromosomal Location 41029275-41059523 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41042933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 274 (L274P)
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
AlphaFold P09838
Predicted Effect probably damaging
Transcript: ENSMUST00000051806
AA Change: L274P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: L274P

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112200
AA Change: L274P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: L274P

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Meta Mutation Damage Score 0.6217 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
catbird UTSW 19 41053233 missense probably damaging 1.00
mimetic UTSW 19 41037139 splice site probably benign
wren UTSW 19 41055758 critical splice acceptor site probably null
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0377:Dntt UTSW 19 41047627 nonsense probably null
R0604:Dntt UTSW 19 41053149 missense probably benign 0.01
R1350:Dntt UTSW 19 41037139 splice site probably benign
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R4999:Dntt UTSW 19 41039856 missense probably damaging 0.99
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R6757:Dntt UTSW 19 41037162 missense probably damaging 1.00
R7340:Dntt UTSW 19 41058565 critical splice acceptor site probably null
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
R7553:Dntt UTSW 19 41029487 missense probably damaging 0.99
R7806:Dntt UTSW 19 41029632 missense probably benign 0.02
R8145:Dntt UTSW 19 41055785 missense probably damaging 1.00
R8940:Dntt UTSW 19 41058551 intron probably benign
R9085:Dntt UTSW 19 41055781 missense probably damaging 1.00
R9110:Dntt UTSW 19 41055758 critical splice acceptor site probably null
R9378:Dntt UTSW 19 41038917 missense probably benign 0.05
YA93:Dntt UTSW 19 41053187 missense probably benign
Z1177:Dntt UTSW 19 41055815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGACTTTGGAAAGTGTCGCTC -3'
(R):5'- TCTTACACAGGGAGACAGCCAGAC -3'

Sequencing Primer
(F):5'- CTCTGTTGTCATAGCAACGATTTG -3'
(R):5'- accagtgaggcaacgaag -3'
Posted On 2013-05-09