Incidental Mutation 'R4771:Spen'
ID367480
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4771 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141472596 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2884 (T2884A)
Ref Sequence ENSEMBL: ENSMUSP00000077925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably benign
Transcript: ENSMUST00000078886
AA Change: T2884A

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T2884A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
AA Change: T2907A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T2907A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,558,973 L190P probably damaging Het
2310022B05Rik T C 8: 124,639,561 T148A probably benign Het
Abcc4 G T 14: 118,484,384 N1234K probably benign Het
Adamts20 C T 15: 94,351,635 probably null Het
Aqp9 C T 9: 71,122,870 G212S probably damaging Het
Asb15 A T 6: 24,570,622 N533I probably damaging Het
Brwd1 A G 16: 96,003,318 V1884A probably benign Het
Casc4 T A 2: 121,925,645 V352E probably damaging Het
Ccdc106 G A 7: 5,057,522 probably null Het
Cfap46 A T 7: 139,630,608 L1774Q probably null Het
Clec2h G A 6: 128,674,155 E133K probably damaging Het
Cntn1 T A 15: 92,305,091 F751L possibly damaging Het
Col20a1 A T 2: 180,989,124 M62L probably benign Het
Col7a1 T C 9: 108,971,925 V1899A probably damaging Het
Cpa5 T A 6: 30,612,685 L28* probably null Het
Crb1 T A 1: 139,328,204 E264D probably damaging Het
Creb3l2 A T 6: 37,334,577 S426T probably benign Het
Cspg5 T A 9: 110,251,127 N373K probably damaging Het
Ctso T C 3: 81,932,740 S26P probably benign Het
Depdc1b A C 13: 108,382,900 D348A probably benign Het
Diaph1 A T 18: 37,853,551 M1127K probably damaging Het
Dlgap1 A T 17: 70,593,380 K397* probably null Het
Dock3 T A 9: 106,952,358 H1119L possibly damaging Het
Dok4 G T 8: 94,865,167 probably null Het
Dram2 A G 3: 106,573,045 T225A probably damaging Het
Dst G A 1: 34,249,484 R5603H probably damaging Het
Ehbp1l1 A G 19: 5,725,968 F18S probably damaging Het
Epha5 A G 5: 84,150,419 V427A probably damaging Het
Exoc4 A T 6: 33,441,949 probably null Het
Exph5 C T 9: 53,373,665 T682I possibly damaging Het
Fam35a G A 14: 34,268,706 T81M probably damaging Het
Fam92a T A 4: 12,155,689 Q311L probably benign Het
Fnbp1l A T 3: 122,558,103 S264T possibly damaging Het
Ggnbp2 A T 11: 84,834,488 D580E probably benign Het
Gm10277 G A 11: 77,785,708 probably benign Het
Gtf2a1l C A 17: 88,690,020 P93Q probably benign Het
Hydin A T 8: 110,532,883 I2496F probably benign Het
Ighv7-2 A C 12: 113,912,467 I6S probably benign Het
Irs1 A G 1: 82,287,975 V840A probably benign Het
Itgal A G 7: 127,328,233 E965G probably damaging Het
Izumo1 T G 7: 45,622,809 F5V probably benign Het
Izumo1 T A 7: 45,622,810 F5Y probably damaging Het
Kif13a A G 13: 46,825,211 S175P probably damaging Het
Klf14 A G 6: 30,958,025 F225L probably damaging Het
Kpna1 T C 16: 36,033,403 Y468H probably damaging Het
Krt5 T A 15: 101,709,059 Q413L probably damaging Het
Lbr T C 1: 181,838,421 Y41C probably damaging Het
Lmcd1 A T 6: 112,315,873 N229Y probably damaging Het
March3 T A 18: 56,783,098 H175L probably benign Het
Mcmbp A G 7: 128,698,400 probably null Het
Med27 T A 2: 29,413,503 L16Q probably damaging Het
Mex3b A T 7: 82,869,065 Q196L possibly damaging Het
Mga T C 2: 119,964,294 S2820P probably damaging Het
Mroh2a C T 1: 88,251,365 L1104F probably damaging Het
Mta3 A G 17: 83,755,674 E166G probably damaging Het
Mthfd2l A G 5: 90,948,868 E116G possibly damaging Het
Musk A G 4: 58,301,706 I155V probably benign Het
Myh7b G A 2: 155,626,394 W834* probably null Het
Myo18b T A 5: 112,692,227 R2567* probably null Het
Nars2 A T 7: 97,035,245 E325V probably damaging Het
Nploc4 A G 11: 120,421,434 V106A possibly damaging Het
Nudcd1 A T 15: 44,405,482 S167R probably damaging Het
Nup133 T A 8: 123,929,398 D448V probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr495 A T 7: 108,396,022 K301* probably null Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdh8 C T 14: 79,768,270 A893T possibly damaging Het
Per3 A T 4: 151,009,259 V1033E probably damaging Het
Polr1e T C 4: 45,019,282 S44P probably damaging Het
Pou4f2 T A 8: 78,435,236 H246L possibly damaging Het
Psmd2 G A 16: 20,662,679 R828Q probably damaging Het
Ptprq A G 10: 107,688,427 S482P probably benign Het
Rbm14 G T 19: 4,802,643 probably benign Het
Reln T C 5: 22,049,700 D557G probably damaging Het
Rhobtb2 A G 14: 69,797,050 I242T probably benign Het
Runx1 C A 16: 92,695,741 V5L possibly damaging Het
Slc13a1 A T 6: 24,100,340 Y381* probably null Het
Smyd3 A T 1: 179,094,396 C180S probably damaging Het
Sntg2 T A 12: 30,276,659 probably null Het
Snx19 G A 9: 30,433,638 V678I probably damaging Het
Spag5 G A 11: 78,304,766 A300T probably damaging Het
Spdl1 T A 11: 34,813,327 R560W probably damaging Het
Spg11 G A 2: 122,065,482 Q1752* probably null Het
Srrm4 C A 5: 116,475,175 probably null Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Sspo A G 6: 48,460,879 D1324G probably damaging Het
Tkt T G 14: 30,567,025 I238S probably damaging Het
Tmem184b A T 15: 79,377,177 N76K probably benign Het
Trpm6 A G 19: 18,813,493 M631V probably damaging Het
Ttll6 A C 11: 96,133,829 E15A possibly damaging Het
Ttn T C 2: 76,738,952 D27199G probably damaging Het
Ubn2 A T 6: 38,487,153 probably null Het
Ubr5 A C 15: 38,018,297 I866M possibly damaging Het
Urb1 T C 16: 90,753,518 T2149A probably benign Het
Ush2a G T 1: 188,797,769 V3252L possibly damaging Het
Usp24 A G 4: 106,362,180 probably null Het
Vill T A 9: 119,068,434 M259K probably damaging Het
Vldlr T C 19: 27,239,890 I411T probably damaging Het
Vmn2r120 A T 17: 57,524,887 W301R probably damaging Het
Vps13b G A 15: 35,910,800 S3570N probably damaging Het
Vps13c T C 9: 67,929,539 V1773A probably benign Het
Vtn A G 11: 78,501,574 D326G probably benign Het
Wdr93 A T 7: 79,776,763 H592L probably damaging Het
Zdhhc19 A G 16: 32,499,135 D94G probably damaging Het
Zfand4 A T 6: 116,314,350 E188V probably damaging Het
Zfp523 C A 17: 28,201,338 probably null Het
Zfp536 T C 7: 37,568,884 D369G probably damaging Het
Zfp608 T A 18: 54,988,300 T72S probably benign Het
Zfp804a T A 2: 82,257,942 V705E probably benign Het
Zfp974 T C 7: 27,926,308 T46A probably damaging Het
Zkscan4 C T 13: 21,479,246 Q52* probably null Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
R7858:Spen UTSW 4 141488131 splice site probably null
R8033:Spen UTSW 4 141471746 missense probably benign 0.03
R8064:Spen UTSW 4 141475700 missense possibly damaging 0.53
R8159:Spen UTSW 4 141475003 missense possibly damaging 0.53
R8187:Spen UTSW 4 141472905 missense possibly damaging 0.93
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCACCTCTGCAGGCAGTTTG -3'
(R):5'- TCCCAAGTGAAAGCAGACTC -3'

Sequencing Primer
(F):5'- CAGGCAGTTTGCTGGGCAG -3'
(R):5'- GTCTGCACCCAAAGGCC -3'
Posted On2015-12-29