Incidental Mutation 'R4771:Epha5'
ID367484
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4771 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84150419 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 427 (V427A)
Ref Sequence ENSEMBL: ENSMUSP00000109025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect probably damaging
Transcript: ENSMUST00000053733
AA Change: V375A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: V375A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113398
AA Change: V427A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: V427A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113399
AA Change: V539A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: V539A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113401
AA Change: V375A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: V375A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113403
AA Change: V539A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: V539A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113406
AA Change: V539A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: V539A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154804
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,558,973 L190P probably damaging Het
2310022B05Rik T C 8: 124,639,561 T148A probably benign Het
Abcc4 G T 14: 118,484,384 N1234K probably benign Het
Adamts20 C T 15: 94,351,635 probably null Het
Aqp9 C T 9: 71,122,870 G212S probably damaging Het
Asb15 A T 6: 24,570,622 N533I probably damaging Het
Brwd1 A G 16: 96,003,318 V1884A probably benign Het
Casc4 T A 2: 121,925,645 V352E probably damaging Het
Ccdc106 G A 7: 5,057,522 probably null Het
Cfap46 A T 7: 139,630,608 L1774Q probably null Het
Clec2h G A 6: 128,674,155 E133K probably damaging Het
Cntn1 T A 15: 92,305,091 F751L possibly damaging Het
Col20a1 A T 2: 180,989,124 M62L probably benign Het
Col7a1 T C 9: 108,971,925 V1899A probably damaging Het
Cpa5 T A 6: 30,612,685 L28* probably null Het
Crb1 T A 1: 139,328,204 E264D probably damaging Het
Creb3l2 A T 6: 37,334,577 S426T probably benign Het
Cspg5 T A 9: 110,251,127 N373K probably damaging Het
Ctso T C 3: 81,932,740 S26P probably benign Het
Depdc1b A C 13: 108,382,900 D348A probably benign Het
Diaph1 A T 18: 37,853,551 M1127K probably damaging Het
Dlgap1 A T 17: 70,593,380 K397* probably null Het
Dock3 T A 9: 106,952,358 H1119L possibly damaging Het
Dok4 G T 8: 94,865,167 probably null Het
Dram2 A G 3: 106,573,045 T225A probably damaging Het
Dst G A 1: 34,249,484 R5603H probably damaging Het
Ehbp1l1 A G 19: 5,725,968 F18S probably damaging Het
Exoc4 A T 6: 33,441,949 probably null Het
Exph5 C T 9: 53,373,665 T682I possibly damaging Het
Fam35a G A 14: 34,268,706 T81M probably damaging Het
Fam92a T A 4: 12,155,689 Q311L probably benign Het
Fnbp1l A T 3: 122,558,103 S264T possibly damaging Het
Ggnbp2 A T 11: 84,834,488 D580E probably benign Het
Gm10277 G A 11: 77,785,708 probably benign Het
Gtf2a1l C A 17: 88,690,020 P93Q probably benign Het
Hydin A T 8: 110,532,883 I2496F probably benign Het
Ighv7-2 A C 12: 113,912,467 I6S probably benign Het
Irs1 A G 1: 82,287,975 V840A probably benign Het
Itgal A G 7: 127,328,233 E965G probably damaging Het
Izumo1 T G 7: 45,622,809 F5V probably benign Het
Izumo1 T A 7: 45,622,810 F5Y probably damaging Het
Kif13a A G 13: 46,825,211 S175P probably damaging Het
Klf14 A G 6: 30,958,025 F225L probably damaging Het
Kpna1 T C 16: 36,033,403 Y468H probably damaging Het
Krt5 T A 15: 101,709,059 Q413L probably damaging Het
Lbr T C 1: 181,838,421 Y41C probably damaging Het
Lmcd1 A T 6: 112,315,873 N229Y probably damaging Het
March3 T A 18: 56,783,098 H175L probably benign Het
Mcmbp A G 7: 128,698,400 probably null Het
Med27 T A 2: 29,413,503 L16Q probably damaging Het
Mex3b A T 7: 82,869,065 Q196L possibly damaging Het
Mga T C 2: 119,964,294 S2820P probably damaging Het
Mroh2a C T 1: 88,251,365 L1104F probably damaging Het
Mta3 A G 17: 83,755,674 E166G probably damaging Het
Mthfd2l A G 5: 90,948,868 E116G possibly damaging Het
Musk A G 4: 58,301,706 I155V probably benign Het
Myh7b G A 2: 155,626,394 W834* probably null Het
Myo18b T A 5: 112,692,227 R2567* probably null Het
Nars2 A T 7: 97,035,245 E325V probably damaging Het
Nploc4 A G 11: 120,421,434 V106A possibly damaging Het
Nudcd1 A T 15: 44,405,482 S167R probably damaging Het
Nup133 T A 8: 123,929,398 D448V probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr495 A T 7: 108,396,022 K301* probably null Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdh8 C T 14: 79,768,270 A893T possibly damaging Het
Per3 A T 4: 151,009,259 V1033E probably damaging Het
Polr1e T C 4: 45,019,282 S44P probably damaging Het
Pou4f2 T A 8: 78,435,236 H246L possibly damaging Het
Psmd2 G A 16: 20,662,679 R828Q probably damaging Het
Ptprq A G 10: 107,688,427 S482P probably benign Het
Rbm14 G T 19: 4,802,643 probably benign Het
Reln T C 5: 22,049,700 D557G probably damaging Het
Rhobtb2 A G 14: 69,797,050 I242T probably benign Het
Runx1 C A 16: 92,695,741 V5L possibly damaging Het
Slc13a1 A T 6: 24,100,340 Y381* probably null Het
Smyd3 A T 1: 179,094,396 C180S probably damaging Het
Sntg2 T A 12: 30,276,659 probably null Het
Snx19 G A 9: 30,433,638 V678I probably damaging Het
Spag5 G A 11: 78,304,766 A300T probably damaging Het
Spdl1 T A 11: 34,813,327 R560W probably damaging Het
Spen T C 4: 141,472,596 T2884A probably benign Het
Spg11 G A 2: 122,065,482 Q1752* probably null Het
Srrm4 C A 5: 116,475,175 probably null Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Sspo A G 6: 48,460,879 D1324G probably damaging Het
Tkt T G 14: 30,567,025 I238S probably damaging Het
Tmem184b A T 15: 79,377,177 N76K probably benign Het
Trpm6 A G 19: 18,813,493 M631V probably damaging Het
Ttll6 A C 11: 96,133,829 E15A possibly damaging Het
Ttn T C 2: 76,738,952 D27199G probably damaging Het
Ubn2 A T 6: 38,487,153 probably null Het
Ubr5 A C 15: 38,018,297 I866M possibly damaging Het
Urb1 T C 16: 90,753,518 T2149A probably benign Het
Ush2a G T 1: 188,797,769 V3252L possibly damaging Het
Usp24 A G 4: 106,362,180 probably null Het
Vill T A 9: 119,068,434 M259K probably damaging Het
Vldlr T C 19: 27,239,890 I411T probably damaging Het
Vmn2r120 A T 17: 57,524,887 W301R probably damaging Het
Vps13b G A 15: 35,910,800 S3570N probably damaging Het
Vps13c T C 9: 67,929,539 V1773A probably benign Het
Vtn A G 11: 78,501,574 D326G probably benign Het
Wdr93 A T 7: 79,776,763 H592L probably damaging Het
Zdhhc19 A G 16: 32,499,135 D94G probably damaging Het
Zfand4 A T 6: 116,314,350 E188V probably damaging Het
Zfp523 C A 17: 28,201,338 probably null Het
Zfp536 T C 7: 37,568,884 D369G probably damaging Het
Zfp608 T A 18: 54,988,300 T72S probably benign Het
Zfp804a T A 2: 82,257,942 V705E probably benign Het
Zfp974 T C 7: 27,926,308 T46A probably damaging Het
Zkscan4 C T 13: 21,479,246 Q52* probably null Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 intron probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGGAACTGACAGAGAGCCC -3'
(R):5'- CTGCTTCAGGGGTAAGAGTC -3'

Sequencing Primer
(F):5'- CCCAGAGCCTATCGATCCATGG -3'
(R):5'- GGTAAGAGTCAGAGCTTTGGC -3'
Posted On2015-12-29