Incidental Mutation 'R0413:Cacna1s'
ID36751
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Namecalcium channel, voltage-dependent, L type, alpha 1S subunit
Synonymssj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
MMRRC Submission 038615-MU
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0413 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136052750-136119822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136098209 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1031 (T1031A)
Ref Sequence ENSEMBL: ENSMUSP00000107699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
Predicted Effect probably benign
Transcript: ENSMUST00000112064
AA Change: T1031A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: T1031A

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112068
AA Change: T1031A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: T1031A

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160641
AA Change: T1031A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: T1031A

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161865
AA Change: T784A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: T784A

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (99/100)
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,328,011 probably benign Het
Adh1 C T 3: 138,280,432 T60I probably benign Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
AI464131 G T 4: 41,498,585 H348Q probably benign Het
Arih2 G T 9: 108,616,717 Q166K probably damaging Het
BC027072 T G 17: 71,752,217 D155A probably benign Het
Ccdc102a C A 8: 94,903,286 E542D probably benign Het
Cdk1 T C 10: 69,345,099 I94V probably benign Het
Cep290 C T 10: 100,523,314 Q969* probably null Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Col12a1 T C 9: 79,699,360 T594A probably damaging Het
Cpox A G 16: 58,670,869 T148A possibly damaging Het
Csf3r A G 4: 126,039,667 probably benign Het
Csmd1 A T 8: 16,710,514 C202S probably damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dnah9 T A 11: 66,108,135 Y1029F probably damaging Het
Dok5 T C 2: 170,829,960 probably benign Het
Dusp11 A T 6: 85,952,370 probably benign Het
Edar T C 10: 58,629,440 N34D probably benign Het
Efcab7 C T 4: 99,909,746 T56I probably damaging Het
Entpd1 G A 19: 40,711,285 V47I probably benign Het
Ephx4 A G 5: 107,403,735 N62S probably benign Het
Etaa1 A T 11: 17,946,350 L589* probably null Het
Fam135b T A 15: 71,463,821 N508I probably benign Het
Fam193a T C 5: 34,466,208 V27A possibly damaging Het
Fmnl1 A G 11: 103,194,063 probably benign Het
Fstl1 A C 16: 37,821,154 probably null Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gemin4 T C 11: 76,211,322 Y871C probably benign Het
Gm7247 T C 14: 51,523,472 V166A probably benign Het
Gpcpd1 A T 2: 132,564,623 probably benign Het
Gpnmb A G 6: 49,042,803 D36G probably benign Het
Ido2 C T 8: 24,558,143 probably null Het
Igfn1 G A 1: 135,967,596 T1744I probably benign Het
Inf2 T G 12: 112,601,676 F221V probably damaging Het
Itga10 T A 3: 96,649,059 I170N probably damaging Het
Lrp6 A T 6: 134,507,624 D345E probably damaging Het
Macf1 A T 4: 123,472,269 S2900T probably benign Het
Med13 C A 11: 86,299,207 probably benign Het
Morc3 T C 16: 93,870,474 V507A probably damaging Het
Myadm AC ACC 7: 3,296,760 probably null Het
Myl6 C T 10: 128,492,222 probably benign Het
Mylk T C 16: 34,921,944 V942A probably benign Het
Ncdn G T 4: 126,750,534 T165K possibly damaging Het
Ncf1 T C 5: 134,222,802 probably benign Het
Neb T C 2: 52,290,739 probably benign Het
Nid1 T A 13: 13,482,096 I604N probably benign Het
Nsrp1 T C 11: 77,046,171 R400G probably benign Het
Nup43 T G 10: 7,671,027 I137S probably benign Het
Nynrin A G 14: 55,872,191 N1585S possibly damaging Het
Obscn T A 11: 59,002,997 Y6748F probably benign Het
Olfr1058 G A 2: 86,385,714 R235C probably benign Het
Olfr1211 A G 2: 88,929,562 V251A probably benign Het
Olfr1389 T C 11: 49,431,385 V303A possibly damaging Het
Olfr60 A T 7: 140,345,195 S265T possibly damaging Het
Olfr623 A T 7: 103,660,750 F167I possibly damaging Het
Olfr67 A G 7: 103,788,155 Y41H probably damaging Het
Olfr944 A G 9: 39,218,270 I304M probably benign Het
Olfr992 T C 2: 85,399,675 N286S probably damaging Het
Omg A G 11: 79,502,835 S66P possibly damaging Het
Ormdl1 C T 1: 53,308,819 probably benign Het
Ovch2 T A 7: 107,782,036 I552L probably benign Het
Pcsk9 G T 4: 106,454,341 T231N probably damaging Het
Pgpep1 T C 8: 70,657,450 N22S probably damaging Het
Plb1 T C 5: 32,355,362 F1355L probably damaging Het
Plcg1 G T 2: 160,761,429 L1173F probably damaging Het
Plch2 A T 4: 155,006,916 probably null Het
Ppp1r3g T A 13: 35,969,348 F250L probably damaging Het
Prkcg A G 7: 3,319,579 I381V probably benign Het
Pum2 C T 12: 8,713,464 A207V probably benign Het
Rabac1 T C 7: 24,970,182 E166G probably damaging Het
Rad21l G A 2: 151,651,931 S450L probably benign Het
Rangap1 ACACTCA ACA 15: 81,716,675 probably null Het
Reg3b G T 6: 78,371,841 C40F probably damaging Het
Rfx2 A G 17: 56,784,418 probably benign Het
Rrp15 G A 1: 186,749,149 probably benign Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Sec61a2 A T 2: 5,876,354 probably benign Het
Sema5a A G 15: 32,669,444 K705E probably damaging Het
Setx A G 2: 29,139,278 Y186C probably damaging Het
Slc22a23 T C 13: 34,183,132 E631G probably damaging Het
Slc5a5 T C 8: 70,891,675 T134A possibly damaging Het
Stx7 T C 10: 24,181,594 S173P probably damaging Het
Sybu T C 15: 44,673,272 T353A probably damaging Het
Syde2 T A 3: 146,007,132 N1008K probably damaging Het
Tiam1 T C 16: 89,809,365 probably benign Het
Timm10b G A 7: 105,678,330 E61K probably benign Het
Tm2d1 A G 4: 98,365,573 I121T probably damaging Het
Trim75 T C 8: 64,983,240 E186G probably benign Het
Tti1 T C 2: 157,995,476 K895E probably benign Het
Vmn1r43 A G 6: 89,869,848 S219P probably damaging Het
Vmn2r73 A T 7: 85,871,879 S294T possibly damaging Het
Vmn2r94 A T 17: 18,243,818 F737I probably damaging Het
Vsx2 A T 12: 84,570,003 T21S probably benign Het
Wrb T G 16: 96,153,017 S105R probably benign Het
Zfp462 G T 4: 55,010,534 R833S probably damaging Het
Zfpl1 G A 19: 6,082,452 P143L probably damaging Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
BB009:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
BB019:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0255:Cacna1s UTSW 1 136118806 missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0482:Cacna1s UTSW 1 136113394 missense probably benign
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1518:Cacna1s UTSW 1 136098551 missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136110937 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4581:Cacna1s UTSW 1 136070970 splice site probably null
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136101564 critical splice donor site probably null
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5411:Cacna1s UTSW 1 136105811 missense probably benign 0.09
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
R7017:Cacna1s UTSW 1 136095858 missense probably damaging 0.99
R7228:Cacna1s UTSW 1 136071059 missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136073708 missense probably damaging 1.00
R7357:Cacna1s UTSW 1 136071021 missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136092633 missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136086802 missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136085449 nonsense probably null
R7519:Cacna1s UTSW 1 136070756 missense probably damaging 0.99
R7675:Cacna1s UTSW 1 136110874 missense probably damaging 1.00
R7746:Cacna1s UTSW 1 136069018 missense probably damaging 0.99
R7779:Cacna1s UTSW 1 136119029 missense probably damaging 1.00
R7850:Cacna1s UTSW 1 136071048 missense probably damaging 1.00
R7932:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
R7935:Cacna1s UTSW 1 136092595 missense possibly damaging 0.62
R7950:Cacna1s UTSW 1 136100625 missense probably benign 0.01
R7969:Cacna1s UTSW 1 136076732 missense probably damaging 1.00
R8083:Cacna1s UTSW 1 136095791 missense possibly damaging 0.91
R8101:Cacna1s UTSW 1 136118665 missense probably benign 0.02
R8123:Cacna1s UTSW 1 136108179 missense probably damaging 1.00
R8191:Cacna1s UTSW 1 136108155 missense probably damaging 1.00
R8194:Cacna1s UTSW 1 136077692 missense probably benign 0.33
R8251:Cacna1s UTSW 1 136086723 missense probably damaging 1.00
R8265:Cacna1s UTSW 1 136092626 nonsense probably null
R8310:Cacna1s UTSW 1 136087337 missense probably damaging 1.00
R8359:Cacna1s UTSW 1 136116061 missense probably benign 0.21
R8461:Cacna1s UTSW 1 136073702 missense possibly damaging 0.53
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Z1176:Cacna1s UTSW 1 136107084 nonsense probably null
Z1177:Cacna1s UTSW 1 136117686 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACTGTGGTAGAAGAGATGCCCC -3'
(R):5'- ATAGGCTAGGACTGGACCTCAATGG -3'

Sequencing Primer
(F):5'- ATGCCCCTGGAAAGGCAG -3'
(R):5'- tgtgagcctcagttttccatc -3'
Posted On2013-05-09