Mutagenetix > Incidental Mutation

Incidental Mutation 'R4771:Ubr5'

367543

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4771 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 38018297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 866 (I866M)

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110336
AA Change: I860M

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: I860M

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226414
AA Change: I866M

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000227143

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028P14Rik	A	G	19: 23,558,973	L190P	probably damaging	Het
2310022B05Rik	T	C	8: 124,639,561	T148A	probably benign	Het
Abcc4	G	T	14: 118,484,384	N1234K	probably benign	Het
Adamts20	C	T	15: 94,351,635		probably null	Het
Aqp9	C	T	9: 71,122,870	G212S	probably damaging	Het
Asb15	A	T	6: 24,570,622	N533I	probably damaging	Het
Brwd1	A	G	16: 96,003,318	V1884A	probably benign	Het
Casc4	T	A	2: 121,925,645	V352E	probably damaging	Het
Ccdc106	G	A	7: 5,057,522		probably null	Het
Cfap46	A	T	7: 139,630,608	L1774Q	probably null	Het
Clec2h	G	A	6: 128,674,155	E133K	probably damaging	Het
Cntn1	T	A	15: 92,305,091	F751L	possibly damaging	Het
Col20a1	A	T	2: 180,989,124	M62L	probably benign	Het
Col7a1	T	C	9: 108,971,925	V1899A	probably damaging	Het
Cpa5	T	A	6: 30,612,685	L28*	probably null	Het
Crb1	T	A	1: 139,328,204	E264D	probably damaging	Het
Creb3l2	A	T	6: 37,334,577	S426T	probably benign	Het
Cspg5	T	A	9: 110,251,127	N373K	probably damaging	Het
Ctso	T	C	3: 81,932,740	S26P	probably benign	Het
Depdc1b	A	C	13: 108,382,900	D348A	probably benign	Het
Diaph1	A	T	18: 37,853,551	M1127K	probably damaging	Het
Dlgap1	A	T	17: 70,593,380	K397*	probably null	Het
Dock3	T	A	9: 106,952,358	H1119L	possibly damaging	Het
Dok4	G	T	8: 94,865,167		probably null	Het
Dram2	A	G	3: 106,573,045	T225A	probably damaging	Het
Dst	G	A	1: 34,249,484	R5603H	probably damaging	Het
Ehbp1l1	A	G	19: 5,725,968	F18S	probably damaging	Het
Epha5	A	G	5: 84,150,419	V427A	probably damaging	Het
Exoc4	A	T	6: 33,441,949		probably null	Het
Exph5	C	T	9: 53,373,665	T682I	possibly damaging	Het
Fam35a	G	A	14: 34,268,706	T81M	probably damaging	Het
Fam92a	T	A	4: 12,155,689	Q311L	probably benign	Het
Fnbp1l	A	T	3: 122,558,103	S264T	possibly damaging	Het
Ggnbp2	A	T	11: 84,834,488	D580E	probably benign	Het
Gm10277	G	A	11: 77,785,708		probably benign	Het
Gtf2a1l	C	A	17: 88,690,020	P93Q	probably benign	Het
Hydin	A	T	8: 110,532,883	I2496F	probably benign	Het
Ighv7-2	A	C	12: 113,912,467	I6S	probably benign	Het
Irs1	A	G	1: 82,287,975	V840A	probably benign	Het
Itgal	A	G	7: 127,328,233	E965G	probably damaging	Het
Izumo1	T	G	7: 45,622,809	F5V	probably benign	Het
Izumo1	T	A	7: 45,622,810	F5Y	probably damaging	Het
Kif13a	A	G	13: 46,825,211	S175P	probably damaging	Het
Klf14	A	G	6: 30,958,025	F225L	probably damaging	Het
Kpna1	T	C	16: 36,033,403	Y468H	probably damaging	Het
Krt5	T	A	15: 101,709,059	Q413L	probably damaging	Het
Lbr	T	C	1: 181,838,421	Y41C	probably damaging	Het
Lmcd1	A	T	6: 112,315,873	N229Y	probably damaging	Het
March3	T	A	18: 56,783,098	H175L	probably benign	Het
Mcmbp	A	G	7: 128,698,400		probably null	Het
Med27	T	A	2: 29,413,503	L16Q	probably damaging	Het
Mex3b	A	T	7: 82,869,065	Q196L	possibly damaging	Het
Mga	T	C	2: 119,964,294	S2820P	probably damaging	Het
Mroh2a	C	T	1: 88,251,365	L1104F	probably damaging	Het
Mta3	A	G	17: 83,755,674	E166G	probably damaging	Het
Mthfd2l	A	G	5: 90,948,868	E116G	possibly damaging	Het
Musk	A	G	4: 58,301,706	I155V	probably benign	Het
Myh7b	G	A	2: 155,626,394	W834*	probably null	Het
Myo18b	T	A	5: 112,692,227	R2567*	probably null	Het
Nars2	A	T	7: 97,035,245	E325V	probably damaging	Het
Nploc4	A	G	11: 120,421,434	V106A	possibly damaging	Het
Nudcd1	A	T	15: 44,405,482	S167R	probably damaging	Het
Nup133	T	A	8: 123,929,398	D448V	probably damaging	Het
Olfr1042	G	T	2: 86,160,073	T99N	probably benign	Het
Olfr495	A	T	7: 108,396,022	K301*	probably null	Het
Pax6	C	A	2: 105,696,502	P251Q	probably benign	Het
Pcdh8	C	T	14: 79,768,270	A893T	possibly damaging	Het
Per3	A	T	4: 151,009,259	V1033E	probably damaging	Het
Polr1e	T	C	4: 45,019,282	S44P	probably damaging	Het
Pou4f2	T	A	8: 78,435,236	H246L	possibly damaging	Het
Psmd2	G	A	16: 20,662,679	R828Q	probably damaging	Het
Ptprq	A	G	10: 107,688,427	S482P	probably benign	Het
Rbm14	G	T	19: 4,802,643		probably benign	Het
Reln	T	C	5: 22,049,700	D557G	probably damaging	Het
Rhobtb2	A	G	14: 69,797,050	I242T	probably benign	Het
Runx1	C	A	16: 92,695,741	V5L	possibly damaging	Het
Slc13a1	A	T	6: 24,100,340	Y381*	probably null	Het
Smyd3	A	T	1: 179,094,396	C180S	probably damaging	Het
Sntg2	T	A	12: 30,276,659		probably null	Het
Snx19	G	A	9: 30,433,638	V678I	probably damaging	Het
Spag5	G	A	11: 78,304,766	A300T	probably damaging	Het
Spdl1	T	A	11: 34,813,327	R560W	probably damaging	Het
Spen	T	C	4: 141,472,596	T2884A	probably benign	Het
Spg11	G	A	2: 122,065,482	Q1752*	probably null	Het
Srrm4	C	A	5: 116,475,175		probably null	Het
Ssc4d	A	G	5: 135,970,220	L43P	probably damaging	Het
Sspo	A	G	6: 48,460,879	D1324G	probably damaging	Het
Tkt	T	G	14: 30,567,025	I238S	probably damaging	Het
Tmem184b	A	T	15: 79,377,177	N76K	probably benign	Het
Trpm6	A	G	19: 18,813,493	M631V	probably damaging	Het
Ttll6	A	C	11: 96,133,829	E15A	possibly damaging	Het
Ttn	T	C	2: 76,738,952	D27199G	probably damaging	Het
Ubn2	A	T	6: 38,487,153		probably null	Het
Urb1	T	C	16: 90,753,518	T2149A	probably benign	Het
Ush2a	G	T	1: 188,797,769	V3252L	possibly damaging	Het
Usp24	A	G	4: 106,362,180		probably null	Het
Vill	T	A	9: 119,068,434	M259K	probably damaging	Het
Vldlr	T	C	19: 27,239,890	I411T	probably damaging	Het
Vmn2r120	A	T	17: 57,524,887	W301R	probably damaging	Het
Vps13b	G	A	15: 35,910,800	S3570N	probably damaging	Het
Vps13c	T	C	9: 67,929,539	V1773A	probably benign	Het
Vtn	A	G	11: 78,501,574	D326G	probably benign	Het
Wdr93	A	T	7: 79,776,763	H592L	probably damaging	Het
Zdhhc19	A	G	16: 32,499,135	D94G	probably damaging	Het
Zfand4	A	T	6: 116,314,350	E188V	probably damaging	Het
Zfp523	C	A	17: 28,201,338		probably null	Het
Zfp536	T	C	7: 37,568,884	D369G	probably damaging	Het
Zfp608	T	A	18: 54,988,300	T72S	probably benign	Het
Zfp804a	T	A	2: 82,257,942	V705E	probably benign	Het
Zfp974	T	C	7: 27,926,308	T46A	probably damaging	Het
Zkscan4	C	T	13: 21,479,246	Q52*	probably null	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
R8745:Ubr5	UTSW	15	38024795	missense
R8811:Ubr5	UTSW	15	38040879	missense
R8904:Ubr5	UTSW	15	38041909	missense
R8955:Ubr5	UTSW	15	38029581	missense
R8956:Ubr5	UTSW	15	38015123	missense	probably damaging	1.00
R9051:Ubr5	UTSW	15	38002259	missense
R9102:Ubr5	UTSW	15	38018352	missense
R9183:Ubr5	UTSW	15	37997176	missense
R9235:Ubr5	UTSW	15	38045738	missense
R9392:Ubr5	UTSW	15	37984007	missense
R9473:Ubr5	UTSW	15	38002373	missense
R9596:Ubr5	UTSW	15	37985969	missense
R9659:Ubr5	UTSW	15	37984010	missense
R9683:Ubr5	UTSW	15	37978027	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- ACTTCCTCAAAAGCTTGCCC -3'
(R):5'- CCTATTGTTCTTCGAGATGGAAATGG -3'

Sequencing Primer
(F):5'- CTCTTCATCAATATGCTATCCAACAG -3'
(R):5'- CGAGATGGAAATGGTACTATCTACCC -3'

Posted On

2015-12-29