Mutagenetix > Incidental Mutation

Incidental Mutation 'R4771:Trpm6'

367566

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4771 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18813493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 631 (M631V)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000040489
AA Change: M631V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: M631V

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028P14Rik	A	G	19: 23,558,973	L190P	probably damaging	Het
2310022B05Rik	T	C	8: 124,639,561	T148A	probably benign	Het
Abcc4	G	T	14: 118,484,384	N1234K	probably benign	Het
Adamts20	C	T	15: 94,351,635		probably null	Het
Aqp9	C	T	9: 71,122,870	G212S	probably damaging	Het
Asb15	A	T	6: 24,570,622	N533I	probably damaging	Het
Brwd1	A	G	16: 96,003,318	V1884A	probably benign	Het
Casc4	T	A	2: 121,925,645	V352E	probably damaging	Het
Ccdc106	G	A	7: 5,057,522		probably null	Het
Cfap46	A	T	7: 139,630,608	L1774Q	probably null	Het
Clec2h	G	A	6: 128,674,155	E133K	probably damaging	Het
Cntn1	T	A	15: 92,305,091	F751L	possibly damaging	Het
Col20a1	A	T	2: 180,989,124	M62L	probably benign	Het
Col7a1	T	C	9: 108,971,925	V1899A	probably damaging	Het
Cpa5	T	A	6: 30,612,685	L28*	probably null	Het
Crb1	T	A	1: 139,328,204	E264D	probably damaging	Het
Creb3l2	A	T	6: 37,334,577	S426T	probably benign	Het
Cspg5	T	A	9: 110,251,127	N373K	probably damaging	Het
Ctso	T	C	3: 81,932,740	S26P	probably benign	Het
Depdc1b	A	C	13: 108,382,900	D348A	probably benign	Het
Diaph1	A	T	18: 37,853,551	M1127K	probably damaging	Het
Dlgap1	A	T	17: 70,593,380	K397*	probably null	Het
Dock3	T	A	9: 106,952,358	H1119L	possibly damaging	Het
Dok4	G	T	8: 94,865,167		probably null	Het
Dram2	A	G	3: 106,573,045	T225A	probably damaging	Het
Dst	G	A	1: 34,249,484	R5603H	probably damaging	Het
Ehbp1l1	A	G	19: 5,725,968	F18S	probably damaging	Het
Epha5	A	G	5: 84,150,419	V427A	probably damaging	Het
Exoc4	A	T	6: 33,441,949		probably null	Het
Exph5	C	T	9: 53,373,665	T682I	possibly damaging	Het
Fam35a	G	A	14: 34,268,706	T81M	probably damaging	Het
Fam92a	T	A	4: 12,155,689	Q311L	probably benign	Het
Fnbp1l	A	T	3: 122,558,103	S264T	possibly damaging	Het
Ggnbp2	A	T	11: 84,834,488	D580E	probably benign	Het
Gm10277	G	A	11: 77,785,708		probably benign	Het
Gtf2a1l	C	A	17: 88,690,020	P93Q	probably benign	Het
Hydin	A	T	8: 110,532,883	I2496F	probably benign	Het
Ighv7-2	A	C	12: 113,912,467	I6S	probably benign	Het
Irs1	A	G	1: 82,287,975	V840A	probably benign	Het
Itgal	A	G	7: 127,328,233	E965G	probably damaging	Het
Izumo1	T	G	7: 45,622,809	F5V	probably benign	Het
Izumo1	T	A	7: 45,622,810	F5Y	probably damaging	Het
Kif13a	A	G	13: 46,825,211	S175P	probably damaging	Het
Klf14	A	G	6: 30,958,025	F225L	probably damaging	Het
Kpna1	T	C	16: 36,033,403	Y468H	probably damaging	Het
Krt5	T	A	15: 101,709,059	Q413L	probably damaging	Het
Lbr	T	C	1: 181,838,421	Y41C	probably damaging	Het
Lmcd1	A	T	6: 112,315,873	N229Y	probably damaging	Het
March3	T	A	18: 56,783,098	H175L	probably benign	Het
Mcmbp	A	G	7: 128,698,400		probably null	Het
Med27	T	A	2: 29,413,503	L16Q	probably damaging	Het
Mex3b	A	T	7: 82,869,065	Q196L	possibly damaging	Het
Mga	T	C	2: 119,964,294	S2820P	probably damaging	Het
Mroh2a	C	T	1: 88,251,365	L1104F	probably damaging	Het
Mta3	A	G	17: 83,755,674	E166G	probably damaging	Het
Mthfd2l	A	G	5: 90,948,868	E116G	possibly damaging	Het
Musk	A	G	4: 58,301,706	I155V	probably benign	Het
Myh7b	G	A	2: 155,626,394	W834*	probably null	Het
Myo18b	T	A	5: 112,692,227	R2567*	probably null	Het
Nars2	A	T	7: 97,035,245	E325V	probably damaging	Het
Nploc4	A	G	11: 120,421,434	V106A	possibly damaging	Het
Nudcd1	A	T	15: 44,405,482	S167R	probably damaging	Het
Nup133	T	A	8: 123,929,398	D448V	probably damaging	Het
Olfr1042	G	T	2: 86,160,073	T99N	probably benign	Het
Olfr495	A	T	7: 108,396,022	K301*	probably null	Het
Pax6	C	A	2: 105,696,502	P251Q	probably benign	Het
Pcdh8	C	T	14: 79,768,270	A893T	possibly damaging	Het
Per3	A	T	4: 151,009,259	V1033E	probably damaging	Het
Polr1e	T	C	4: 45,019,282	S44P	probably damaging	Het
Pou4f2	T	A	8: 78,435,236	H246L	possibly damaging	Het
Psmd2	G	A	16: 20,662,679	R828Q	probably damaging	Het
Ptprq	A	G	10: 107,688,427	S482P	probably benign	Het
Rbm14	G	T	19: 4,802,643		probably benign	Het
Reln	T	C	5: 22,049,700	D557G	probably damaging	Het
Rhobtb2	A	G	14: 69,797,050	I242T	probably benign	Het
Runx1	C	A	16: 92,695,741	V5L	possibly damaging	Het
Slc13a1	A	T	6: 24,100,340	Y381*	probably null	Het
Smyd3	A	T	1: 179,094,396	C180S	probably damaging	Het
Sntg2	T	A	12: 30,276,659		probably null	Het
Snx19	G	A	9: 30,433,638	V678I	probably damaging	Het
Spag5	G	A	11: 78,304,766	A300T	probably damaging	Het
Spdl1	T	A	11: 34,813,327	R560W	probably damaging	Het
Spen	T	C	4: 141,472,596	T2884A	probably benign	Het
Spg11	G	A	2: 122,065,482	Q1752*	probably null	Het
Srrm4	C	A	5: 116,475,175		probably null	Het
Ssc4d	A	G	5: 135,970,220	L43P	probably damaging	Het
Sspo	A	G	6: 48,460,879	D1324G	probably damaging	Het
Tkt	T	G	14: 30,567,025	I238S	probably damaging	Het
Tmem184b	A	T	15: 79,377,177	N76K	probably benign	Het
Ttll6	A	C	11: 96,133,829	E15A	possibly damaging	Het
Ttn	T	C	2: 76,738,952	D27199G	probably damaging	Het
Ubn2	A	T	6: 38,487,153		probably null	Het
Ubr5	A	C	15: 38,018,297	I866M	possibly damaging	Het
Urb1	T	C	16: 90,753,518	T2149A	probably benign	Het
Ush2a	G	T	1: 188,797,769	V3252L	possibly damaging	Het
Usp24	A	G	4: 106,362,180		probably null	Het
Vill	T	A	9: 119,068,434	M259K	probably damaging	Het
Vldlr	T	C	19: 27,239,890	I411T	probably damaging	Het
Vmn2r120	A	T	17: 57,524,887	W301R	probably damaging	Het
Vps13b	G	A	15: 35,910,800	S3570N	probably damaging	Het
Vps13c	T	C	9: 67,929,539	V1773A	probably benign	Het
Vtn	A	G	11: 78,501,574	D326G	probably benign	Het
Wdr93	A	T	7: 79,776,763	H592L	probably damaging	Het
Zdhhc19	A	G	16: 32,499,135	D94G	probably damaging	Het
Zfand4	A	T	6: 116,314,350	E188V	probably damaging	Het
Zfp523	C	A	17: 28,201,338		probably null	Het
Zfp536	T	C	7: 37,568,884	D369G	probably damaging	Het
Zfp608	T	A	18: 54,988,300	T72S	probably benign	Het
Zfp804a	T	A	2: 82,257,942	V705E	probably benign	Het
Zfp974	T	C	7: 27,926,308	T46A	probably damaging	Het
Zkscan4	C	T	13: 21,479,246	Q52*	probably null	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9564:Trpm6	UTSW	19	18873876	missense	possibly damaging	0.92
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AGCTGTGTTACATTTAGCTGAAC -3'
(R):5'- GTTTCTACATTCTCAAAACTGTTGGTG -3'

Sequencing Primer
(F):5'- TGAACACCATGCATCTGAGTCCTTAG -3'
(R):5'- CATTCTCAAAACTGTTGGTGTTTAG -3'

Posted On

2015-12-29