Incidental Mutation 'R4772:Pkn3'
ID 367576
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Name protein kinase N3
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4772 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 29967696-29981034 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 29974692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000125346] [ENSMUST00000150770]
AlphaFold Q8K045
Predicted Effect probably null
Transcript: ENSMUST00000045246
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125346
SMART Domains Protein: ENSMUSP00000120268
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 19 82 3.45e-17 SMART
Hr1 102 170 6.19e-19 SMART
Hr1 175 238 6.4e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156197
Predicted Effect probably benign
Transcript: ENSMUST00000150770
SMART Domains Protein: ENSMUSP00000114492
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 28 91 3.45e-17 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,265,339 (GRCm39) probably null Het
Adamts19 A G 18: 58,970,848 (GRCm39) Q144R possibly damaging Het
Adgrb3 C A 1: 25,570,956 (GRCm39) C507F probably damaging Het
Atg9b T C 5: 24,590,237 (GRCm39) *923W probably null Het
Atp13a4 T C 16: 29,239,653 (GRCm39) probably benign Het
Baz2b G T 2: 59,788,795 (GRCm39) R697S probably damaging Het
Bicdl1 A G 5: 115,799,537 (GRCm39) I184T probably benign Het
Bpifb4 C T 2: 153,784,903 (GRCm39) L204F possibly damaging Het
Cep120 C T 18: 53,851,561 (GRCm39) R577Q probably damaging Het
Cplx4 T C 18: 66,103,048 (GRCm39) E24G possibly damaging Het
Dcxr T C 11: 120,616,923 (GRCm39) T147A probably benign Het
Dnajc10 C A 2: 80,170,870 (GRCm39) H454N probably damaging Het
Dsp G T 13: 38,351,504 (GRCm39) G108* probably null Het
Entpd6 T A 2: 150,609,014 (GRCm39) I366K probably damaging Het
Fam111a A G 19: 12,565,057 (GRCm39) K269E probably benign Het
Grid2ip T G 5: 143,361,455 (GRCm39) V222G possibly damaging Het
Hmcn2 T G 2: 31,335,326 (GRCm39) V4421G probably benign Het
Ifi207 T C 1: 173,555,253 (GRCm39) T817A probably damaging Het
Irak2 A T 6: 113,670,683 (GRCm39) E533V probably damaging Het
Katnip A G 7: 125,464,523 (GRCm39) S1297G probably damaging Het
Kbtbd6 T C 14: 79,689,596 (GRCm39) F97S probably damaging Het
Kctd14 A T 7: 97,106,883 (GRCm39) E99V probably damaging Het
Klhl10 A T 11: 100,338,557 (GRCm39) Y432F probably benign Het
Lrrc49 T C 9: 60,592,335 (GRCm39) N53S possibly damaging Het
Mief2 T A 11: 60,621,288 (GRCm39) probably benign Het
Mog A T 17: 37,334,049 (GRCm39) S15T unknown Het
Mpi T C 9: 57,452,181 (GRCm39) D365G probably damaging Het
Mpp7 A G 18: 7,379,983 (GRCm39) probably null Het
Nes A G 3: 87,883,486 (GRCm39) T582A probably benign Het
Nlrp14 A G 7: 106,780,393 (GRCm39) D5G probably benign Het
Nr1i3 C T 1: 171,044,719 (GRCm39) T218I probably damaging Het
Nup43 C T 10: 7,554,433 (GRCm39) R339* probably null Het
Nup58 T A 14: 60,457,471 (GRCm39) R577S probably benign Het
Olfr908 C T 9: 38,427,897 (GRCm39) probably benign Het
Or4l15 AAATTTGAA AAA 14: 50,198,452 (GRCm39) probably benign Het
Or52n4b T A 7: 108,144,092 (GRCm39) M120K probably damaging Het
Or5d35 T A 2: 87,855,207 (GRCm39) I47K probably damaging Het
Or6c38 A T 10: 128,929,537 (GRCm39) V102D possibly damaging Het
Or9g20 G A 2: 85,630,338 (GRCm39) S92F probably damaging Het
Orc1 T C 4: 108,436,765 (GRCm39) probably benign Het
Pax6 C A 2: 105,526,847 (GRCm39) P251Q probably benign Het
Phactr3 C T 2: 177,925,729 (GRCm39) R330W probably damaging Het
Phldb1 G A 9: 44,622,324 (GRCm39) R81W probably damaging Het
Pip5k1c C T 10: 81,151,774 (GRCm39) P656L probably benign Het
Plcb2 T A 2: 118,543,615 (GRCm39) H752L probably benign Het
Plch1 G A 3: 63,660,746 (GRCm39) T291M probably damaging Het
Plekhg1 A T 10: 3,823,127 (GRCm39) M32L probably benign Het
Plekhg1 A T 10: 3,823,130 (GRCm39) T33S probably damaging Het
Plk4 A G 3: 40,759,625 (GRCm39) T174A probably damaging Het
Ppip5k2 C A 1: 97,648,792 (GRCm39) probably benign Het
Prl2a1 G A 13: 27,988,961 (GRCm39) V29M probably benign Het
R3hcc1l T C 19: 42,571,996 (GRCm39) probably benign Het
Rasa3 C T 8: 13,648,289 (GRCm39) G125D probably damaging Het
Sema3f A T 9: 107,566,919 (GRCm39) Y136* probably null Het
Slc13a5 T A 11: 72,141,672 (GRCm39) probably null Het
Slc16a1 T C 3: 104,560,880 (GRCm39) V395A possibly damaging Het
Sparcl1 C T 5: 104,236,356 (GRCm39) A466T probably benign Het
Srrm1 G A 4: 135,069,690 (GRCm39) probably benign Het
Styxl1 G A 5: 135,797,755 (GRCm39) R50* probably null Het
Tex264 T A 9: 106,550,901 (GRCm39) I99F possibly damaging Het
Tgtp2 T C 11: 48,949,811 (GRCm39) T254A probably damaging Het
Tmem245 A C 4: 56,937,989 (GRCm39) probably null Het
Tnik A T 3: 28,661,359 (GRCm39) T587S probably benign Het
Tpr T G 1: 150,288,864 (GRCm39) S648A possibly damaging Het
Ttn T C 2: 76,596,313 (GRCm39) E18454G probably damaging Het
Utp20 A C 10: 88,645,797 (GRCm39) H527Q probably benign Het
Vmn1r1 A T 1: 181,985,111 (GRCm39) S185T probably benign Het
Vps54 C T 11: 21,262,952 (GRCm39) H680Y probably damaging Het
Vwa5b2 A G 16: 20,419,553 (GRCm39) probably null Het
Wscd1 T C 11: 71,662,802 (GRCm39) probably null Het
Zbtb41 C T 1: 139,375,152 (GRCm39) P871S probably damaging Het
Zcchc4 T C 5: 52,953,549 (GRCm39) L186P possibly damaging Het
Zdhhc13 A G 7: 48,449,621 (GRCm39) Y73C probably benign Het
Zfp12 A G 5: 143,225,755 (GRCm39) E21G probably damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 29,971,116 (GRCm39) missense probably damaging 0.97
IGL00781:Pkn3 APN 2 29,973,402 (GRCm39) unclassified probably benign
IGL00815:Pkn3 APN 2 29,971,212 (GRCm39) missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 29,977,054 (GRCm39) missense probably damaging 1.00
IGL01897:Pkn3 APN 2 29,972,824 (GRCm39) unclassified probably benign
IGL02513:Pkn3 APN 2 29,973,149 (GRCm39) missense probably damaging 0.98
IGL02552:Pkn3 APN 2 29,970,879 (GRCm39) missense probably damaging 1.00
IGL02622:Pkn3 APN 2 29,973,158 (GRCm39) missense probably benign 0.28
IGL02689:Pkn3 APN 2 29,970,858 (GRCm39) missense probably damaging 1.00
IGL02996:Pkn3 APN 2 29,970,627 (GRCm39) missense probably benign 0.39
IGL03106:Pkn3 APN 2 29,975,257 (GRCm39) missense probably damaging 0.96
Enflamme UTSW 2 29,973,049 (GRCm39) unclassified probably benign
Wrath UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 29,980,539 (GRCm39) missense probably damaging 1.00
R0279:Pkn3 UTSW 2 29,973,309 (GRCm39) missense probably benign 0.16
R0370:Pkn3 UTSW 2 29,977,184 (GRCm39) missense probably damaging 1.00
R0491:Pkn3 UTSW 2 29,979,889 (GRCm39) missense probably damaging 1.00
R0600:Pkn3 UTSW 2 29,971,146 (GRCm39) missense probably benign 0.06
R1418:Pkn3 UTSW 2 29,973,059 (GRCm39) missense probably damaging 1.00
R1510:Pkn3 UTSW 2 29,969,776 (GRCm39) critical splice donor site probably null
R1535:Pkn3 UTSW 2 29,977,065 (GRCm39) missense probably benign
R1540:Pkn3 UTSW 2 29,974,703 (GRCm39) missense probably damaging 1.00
R1808:Pkn3 UTSW 2 29,969,663 (GRCm39) missense probably damaging 1.00
R1884:Pkn3 UTSW 2 29,972,840 (GRCm39) missense probably damaging 1.00
R1995:Pkn3 UTSW 2 29,979,989 (GRCm39) missense probably damaging 1.00
R3745:Pkn3 UTSW 2 29,980,353 (GRCm39) missense probably damaging 1.00
R4119:Pkn3 UTSW 2 29,973,049 (GRCm39) unclassified probably benign
R4258:Pkn3 UTSW 2 29,978,572 (GRCm39) missense probably damaging 0.99
R4665:Pkn3 UTSW 2 29,975,469 (GRCm39) unclassified probably benign
R4808:Pkn3 UTSW 2 29,980,093 (GRCm39) missense probably damaging 1.00
R5038:Pkn3 UTSW 2 29,975,293 (GRCm39) critical splice donor site probably null
R5388:Pkn3 UTSW 2 29,971,086 (GRCm39) missense probably damaging 0.99
R5488:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R5611:Pkn3 UTSW 2 29,969,673 (GRCm39) missense probably damaging 1.00
R6001:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R6277:Pkn3 UTSW 2 29,972,957 (GRCm39) missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 29,970,699 (GRCm39) critical splice donor site probably null
R6724:Pkn3 UTSW 2 29,980,562 (GRCm39) missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 29,973,548 (GRCm39) splice site probably null
R7128:Pkn3 UTSW 2 29,973,327 (GRCm39) missense probably damaging 1.00
R7249:Pkn3 UTSW 2 29,974,773 (GRCm39) missense probably benign 0.00
R7475:Pkn3 UTSW 2 29,977,122 (GRCm39) missense probably benign 0.01
R7746:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7747:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7783:Pkn3 UTSW 2 29,969,634 (GRCm39) missense probably damaging 1.00
R8401:Pkn3 UTSW 2 29,970,071 (GRCm39) missense probably benign 0.00
R8425:Pkn3 UTSW 2 29,976,513 (GRCm39) critical splice donor site probably null
R8535:Pkn3 UTSW 2 29,969,936 (GRCm39) critical splice acceptor site probably null
R8720:Pkn3 UTSW 2 29,975,196 (GRCm39) missense probably benign 0.01
R8743:Pkn3 UTSW 2 29,973,318 (GRCm39) missense probably benign 0.00
R9415:Pkn3 UTSW 2 29,968,332 (GRCm39) missense probably benign 0.20
R9437:Pkn3 UTSW 2 29,973,267 (GRCm39) missense possibly damaging 0.93
R9583:Pkn3 UTSW 2 29,976,723 (GRCm39) missense probably null 0.99
R9800:Pkn3 UTSW 2 29,973,290 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAGGTCCTCTGAGTTTTGCT -3'
(R):5'- TGAAATCCCGGCCTAGAGGAG -3'

Sequencing Primer
(F):5'- CCAGTACCACTTGTCTAGGGAATG -3'
(R):5'- CCTAGAGGAGGCAGGCG -3'
Posted On 2015-12-29