Mutagenetix > Incidental Mutation

Incidental Mutation 'R4772:Mpp7'

367637

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R4772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 7379983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000115869

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

95% (74/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,315,339		probably null	Het
Adamts19	A	G	18: 58,837,776	Q144R	possibly damaging	Het
Adgrb3	C	A	1: 25,531,875	C507F	probably damaging	Het
Atg9b	T	C	5: 24,385,239	*923W	probably null	Het
Atp13a4	T	C	16: 29,420,835		probably benign	Het
Baz2b	G	T	2: 59,958,451	R697S	probably damaging	Het
Bicdl1	A	G	5: 115,661,478	I184T	probably benign	Het
Bpifb4	C	T	2: 153,942,983	L204F	possibly damaging	Het
Cep120	C	T	18: 53,718,489	R577Q	probably damaging	Het
Cplx4	T	C	18: 65,969,977	E24G	possibly damaging	Het
D430042O09Rik	A	G	7: 125,865,351	S1297G	probably damaging	Het
Dcxr	T	C	11: 120,726,097	T147A	probably benign	Het
Dnajc10	C	A	2: 80,340,526	H454N	probably damaging	Het
Dsp	G	T	13: 38,167,528	G108*	probably null	Het
Entpd6	T	A	2: 150,767,094	I366K	probably damaging	Het
Fam111a	A	G	19: 12,587,693	K269E	probably benign	Het
Grid2ip	T	G	5: 143,375,700	V222G	possibly damaging	Het
Hmcn2	T	G	2: 31,445,314	V4421G	probably benign	Het
Ifi207	T	C	1: 173,727,687	T817A	probably damaging	Het
Irak2	A	T	6: 113,693,722	E533V	probably damaging	Het
Kbtbd6	T	C	14: 79,452,156	F97S	probably damaging	Het
Kctd14	A	T	7: 97,457,676	E99V	probably damaging	Het
Klhl10	A	T	11: 100,447,731	Y432F	probably benign	Het
Lrrc49	T	C	9: 60,685,052	N53S	possibly damaging	Het
Mief2	T	A	11: 60,730,462		probably benign	Het
Mog	A	T	17: 37,023,157	S15T	unknown	Het
Mpi	T	C	9: 57,544,898	D365G	probably damaging	Het
Nes	A	G	3: 87,976,179	T582A	probably benign	Het
Nlrp14	A	G	7: 107,181,186	D5G	probably benign	Het
Nr1i3	C	T	1: 171,217,150	T218I	probably damaging	Het
Nup43	C	T	10: 7,678,669	R339*	probably null	Het
Nupl1	T	A	14: 60,220,022	R577S	probably benign	Het
Olfr1016	G	A	2: 85,799,994	S92F	probably damaging	Het
Olfr1161	T	A	2: 88,024,863	I47K	probably damaging	Het
Olfr503	T	A	7: 108,544,885	M120K	probably damaging	Het
Olfr724	AAATTTGAA	AAA	14: 49,960,995		probably benign	Het
Olfr768	A	T	10: 129,093,668	V102D	possibly damaging	Het
Olfr908	C	T	9: 38,516,601		probably benign	Het
Orc1	T	C	4: 108,579,568		probably benign	Het
Pax6	C	A	2: 105,696,502	P251Q	probably benign	Het
Phactr3	C	T	2: 178,283,936	R330W	probably damaging	Het
Phldb1	G	A	9: 44,711,027	R81W	probably damaging	Het
Pip5k1c	C	T	10: 81,315,940	P656L	probably benign	Het
Pkn3	T	G	2: 30,084,680		probably null	Het
Plcb2	T	A	2: 118,713,134	H752L	probably benign	Het
Plch1	G	A	3: 63,753,325	T291M	probably damaging	Het
Plekhg1	A	T	10: 3,873,127	M32L	probably benign	Het
Plekhg1	A	T	10: 3,873,130	T33S	probably damaging	Het
Plk4	A	G	3: 40,805,190	T174A	probably damaging	Het
Ppip5k2	C	A	1: 97,721,067		probably benign	Het
Prl2a1	G	A	13: 27,804,978	V29M	probably benign	Het
R3hcc1l	T	C	19: 42,583,557		probably benign	Het
Rasa3	C	T	8: 13,598,289	G125D	probably damaging	Het
Sema3f	A	T	9: 107,689,720	Y136*	probably null	Het
Slc13a5	T	A	11: 72,250,846		probably null	Het
Slc16a1	T	C	3: 104,653,564	V395A	possibly damaging	Het
Sparcl1	C	T	5: 104,088,490	A466T	probably benign	Het
Srrm1	G	A	4: 135,342,379		probably benign	Het
Styxl1	G	A	5: 135,768,901	R50*	probably null	Het
Tex264	T	A	9: 106,673,702	I99F	possibly damaging	Het
Tgtp2	T	C	11: 49,058,984	T254A	probably damaging	Het
Tmem245	A	C	4: 56,937,989		probably null	Het
Tnik	A	T	3: 28,607,210	T587S	probably benign	Het
Tpr	T	G	1: 150,413,113	S648A	possibly damaging	Het
Ttn	T	C	2: 76,765,969	E18454G	probably damaging	Het
Utp20	A	C	10: 88,809,935	H527Q	probably benign	Het
Vmn1r1	A	T	1: 182,157,546	S185T	probably benign	Het
Vps54	C	T	11: 21,312,952	H680Y	probably damaging	Het
Vwa5b2	A	G	16: 20,600,803		probably null	Het
Wscd1	T	C	11: 71,771,976		probably null	Het
Zbtb41	C	T	1: 139,447,414	P871S	probably damaging	Het
Zcchc4	T	C	5: 52,796,207	L186P	possibly damaging	Het
Zdhhc13	A	G	7: 48,799,873	Y73C	probably benign	Het
Zfp12	A	G	5: 143,240,000	E21G	probably damaging	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGGGGATCCTTGAAACTCTGC -3'
(R):5'- GTGATCATTCAGGATTGTTCAGTAC -3'

Sequencing Primer
(F):5'- TTGAAACTCTGCTGGCCCAG -3'
(R):5'- AACCAATCCTTCTCATGTATAGAGC -3'

Posted On

2015-12-29